ID: 1060446464

View in Genome Browser
Species Human (GRCh38)
Location 9:123693106-123693128
Sequence GTGTATATATAGATGAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060446461_1060446464 -10 Left 1060446461 9:123693093-123693115 CCACCCATTCTATGTGTATATAT 0: 1
1: 0
2: 1
3: 21
4: 325
Right 1060446464 9:123693106-123693128 GTGTATATATAGATGAATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060446464 Original CRISPR GTGTATATATAGATGAATTT TGG Intronic
No off target data available for this crispr