ID: 1060448878

View in Genome Browser
Species Human (GRCh38)
Location 9:123718324-123718346
Sequence GTTGCCAAGCAACCAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060448875_1060448878 29 Left 1060448875 9:123718272-123718294 CCAGGGCCAAAGGGTTAATACAA 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1060448878 9:123718324-123718346 GTTGCCAAGCAACCAAAAGAAGG No data
1060448874_1060448878 30 Left 1060448874 9:123718271-123718293 CCCAGGGCCAAAGGGTTAATACA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1060448878 9:123718324-123718346 GTTGCCAAGCAACCAAAAGAAGG No data
1060448876_1060448878 23 Left 1060448876 9:123718278-123718300 CCAAAGGGTTAATACAAAATGAC 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1060448878 9:123718324-123718346 GTTGCCAAGCAACCAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060448878 Original CRISPR GTTGCCAAGCAACCAAAAGA AGG Intronic
No off target data available for this crispr