ID: 1060449698

View in Genome Browser
Species Human (GRCh38)
Location 9:123725575-123725597
Sequence TTAACCACGAGCAGAACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060449695_1060449698 12 Left 1060449695 9:123725540-123725562 CCAGTAGGCTGTGGTACACAGTT 0: 1
1: 0
2: 0
3: 20
4: 77
Right 1060449698 9:123725575-123725597 TTAACCACGAGCAGAACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060449698 Original CRISPR TTAACCACGAGCAGAACTGC AGG Intronic
No off target data available for this crispr