ID: 1060457742

View in Genome Browser
Species Human (GRCh38)
Location 9:123816267-123816289
Sequence TGGCTCATACCTATAACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8069
Summary {0: 1, 1: 9, 2: 394, 3: 2939, 4: 4726}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060457742_1060457748 26 Left 1060457742 9:123816267-123816289 CCTGGGGTTATAGGTATGAGCCA 0: 1
1: 9
2: 394
3: 2939
4: 4726
Right 1060457748 9:123816316-123816338 CAAGTTCACTAATTTCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060457742 Original CRISPR TGGCTCATACCTATAACCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr