ID: 1060460204

View in Genome Browser
Species Human (GRCh38)
Location 9:123845511-123845533
Sequence CACACCCACTTAATTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 1, 2: 15, 3: 91, 4: 386}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060460204_1060460215 22 Left 1060460204 9:123845511-123845533 CCCCAAAAAATTAAGTGGGTGTG 0: 1
1: 1
2: 15
3: 91
4: 386
Right 1060460215 9:123845556-123845578 GCTACTTGCAAAGCGGAGGTGGG No data
1060460204_1060460214 21 Left 1060460204 9:123845511-123845533 CCCCAAAAAATTAAGTGGGTGTG 0: 1
1: 1
2: 15
3: 91
4: 386
Right 1060460214 9:123845555-123845577 AGCTACTTGCAAAGCGGAGGTGG No data
1060460204_1060460212 18 Left 1060460204 9:123845511-123845533 CCCCAAAAAATTAAGTGGGTGTG 0: 1
1: 1
2: 15
3: 91
4: 386
Right 1060460212 9:123845552-123845574 CCCAGCTACTTGCAAAGCGGAGG No data
1060460204_1060460210 15 Left 1060460204 9:123845511-123845533 CCCCAAAAAATTAAGTGGGTGTG 0: 1
1: 1
2: 15
3: 91
4: 386
Right 1060460210 9:123845549-123845571 AGTCCCAGCTACTTGCAAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060460204 Original CRISPR CACACCCACTTAATTTTTTG GGG (reversed) Intronic
900901236 1:5517565-5517587 TTCACCAACTTATTTTTTTGTGG - Intergenic
901904900 1:12399919-12399941 CTCACATACTTATTTTTTTGAGG + Intronic
903783005 1:25834458-25834480 CACGCCCAGCTAATTTTTTTTGG - Exonic
903927477 1:26840964-26840986 CACATACAGCTAATTTTTTGGGG + Intronic
906412176 1:45587341-45587363 CACACCTGGCTAATTTTTTGGGG + Intronic
906449491 1:45932693-45932715 CAAATCCACTAAATTTTTTTTGG - Intronic
906477535 1:46180072-46180094 CACGCACACTAAATTCTTTGTGG - Intronic
907254803 1:53170839-53170861 CACACCCAGCTAATTTTTGTGGG - Intergenic
907411874 1:54288861-54288883 CACACCCAGCTGATTTTTTTTGG - Intronic
907463882 1:54622580-54622602 CATACCCAGCTAATTTTTTGTGG - Intronic
908084237 1:60613363-60613385 CTCACACACTTAATTTTTGGGGG + Intergenic
908375314 1:63531449-63531471 ACCATCCACTTAATTGTTTGGGG - Intronic
910448510 1:87324016-87324038 CACGCCCAGCTAATTTTTTTTGG - Intergenic
912886975 1:113484879-113484901 CACGCCCAGCTAATTTTTTTTGG + Intronic
913184823 1:116360838-116360860 CCCTCTCACTTTATTTTTTGAGG + Intergenic
913271402 1:117097109-117097131 AGCACTCAGTTAATTTTTTGAGG + Intronic
914326316 1:146620292-146620314 CACACCCAACTAATTTTTGTGGG - Intergenic
914724808 1:150318629-150318651 CACGCCCGGCTAATTTTTTGTGG - Intergenic
915261715 1:154681620-154681642 CACGCCCGCCTAATTTTTTTTGG - Intergenic
916227365 1:162502017-162502039 CACACCCAGCTAATTTTTTGAGG - Intronic
916275285 1:162987383-162987405 CAAACCCATTTAAGATTTTGGGG - Intergenic
916552171 1:165859668-165859690 CACACCCTGCTAATTTTTTGTGG - Intronic
917294130 1:173501665-173501687 CACGCCCAGCTAATTTTTGGTGG + Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918427008 1:184420865-184420887 CATACCAAGTTAATTATTTGAGG + Intronic
918722178 1:187866997-187867019 CACACTCACCTAATTGTTTTGGG + Intergenic
919911825 1:202115951-202115973 CACACCCAGCTAAATTTTAGTGG + Intergenic
920655883 1:207874446-207874468 CACGCCCAGCTAATTTTTTGTGG - Intergenic
921672091 1:217936801-217936823 CACATACATATAATTTTTTGTGG - Intergenic
923250567 1:232176422-232176444 CACACCCAGCTAATTTTTAAAGG - Intergenic
923372149 1:233325517-233325539 CACGCCCAGCTAATTTTTTTTGG - Intergenic
924069491 1:240261759-240261781 CACACACAGGTAATTATTTGGGG - Intronic
924226531 1:241926699-241926721 CACATGGACTTGATTTTTTGCGG + Intergenic
924324042 1:242877577-242877599 CATACCCACTTTATTTCTTAAGG + Intergenic
1063355269 10:5393364-5393386 CTGACCCACTTAATTTAGTGTGG + Exonic
1064061046 10:12137459-12137481 TACACCCAGTTAATTTCTTTTGG + Intronic
1064163865 10:12970451-12970473 CTCACAAACTTATTTTTTTGGGG - Intronic
1064269923 10:13855456-13855478 CACACCCATTTACTTCTCTGGGG + Intronic
1064628909 10:17289336-17289358 CCCTGCCACCTAATTTTTTGAGG + Intergenic
1064707411 10:18087326-18087348 CACAGGCACTTAATTTAATGTGG + Intergenic
1064737627 10:18399018-18399040 CACCCACACATAATTTTGTGCGG - Intronic
1064759324 10:18602217-18602239 CACACCCAGCTAATTTTTGTGGG + Intronic
1065374226 10:25020608-25020630 CACACCCAGCTAATTTTTGTAGG - Intronic
1065545485 10:26815752-26815774 CATACCCAGCTAATTTTTTTGGG - Intronic
1065559571 10:26948836-26948858 CACGCCCAGCTAATTTTTTTGGG - Intergenic
1065567842 10:27032916-27032938 CACACCTGGCTAATTTTTTGTGG - Intronic
1065791107 10:29261840-29261862 CACACCCAGCTAATTTGATGAGG + Intergenic
1066207945 10:33208215-33208237 CACGCCGAGCTAATTTTTTGTGG + Intronic
1066313587 10:34221503-34221525 CTCACGTACTTATTTTTTTGTGG + Intronic
1066373807 10:34839454-34839476 CATGCCTAGTTAATTTTTTGTGG + Intergenic
1067004901 10:42651445-42651467 AACACCCAGTTAATTTTGTAGGG - Intergenic
1069215493 10:65813852-65813874 CACACCAGCTTACTTTTTGGTGG - Intergenic
1069322531 10:67189481-67189503 CTCACATACTTATTTTTTTGTGG - Intronic
1069411607 10:68159953-68159975 CTCACACACATCATTTTTTGTGG + Intronic
1070310354 10:75268842-75268864 CACACCCAGTCAAATTTTTTTGG + Intergenic
1071341605 10:84653851-84653873 CACGCCCAGCTAATATTTTGTGG + Intergenic
1072070497 10:91910561-91910583 AACACCCAGCTAATTTTTAGTGG + Intergenic
1073252649 10:102130889-102130911 CATGCCCAGCTAATTTTTTGGGG - Intergenic
1073569577 10:104565997-104566019 TACACAAACTTATTTTTTTGTGG + Intergenic
1074297034 10:112199546-112199568 CTCACATACTTAATTTTTTGTGG - Intronic
1074846479 10:117403376-117403398 CCCACCCCCATAATCTTTTGAGG - Intergenic
1075555242 10:123426250-123426272 CAAACACACTCAATTTATTGTGG - Intergenic
1075878935 10:125832963-125832985 CATACCCGGCTAATTTTTTGTGG - Intronic
1076428688 10:130386276-130386298 CACACTCACTCAACTTTTTGGGG - Intergenic
1077638826 11:3862891-3862913 CACACACACATATTTTTTTGAGG + Intronic
1078730556 11:13970360-13970382 CACATCCACTGATTTTCTTGAGG + Intronic
1079051460 11:17164193-17164215 CACACCCAGCTAATTTTTTTGGG - Intronic
1079291777 11:19194520-19194542 CACACCAGGGTAATTTTTTGGGG - Intronic
1080191882 11:29560267-29560289 CACGCCCAGCTACTTTTTTGGGG - Intergenic
1082106744 11:48229103-48229125 CACACTCACTTGAATTCTTGCGG + Intergenic
1083055706 11:59817265-59817287 CACACACACACAGTTTTTTGAGG - Intergenic
1083916869 11:65752066-65752088 CATACCCAGCTAATTTTTTTTGG + Intergenic
1084318907 11:68362532-68362554 CACACCCAGCTAATTTTTGGGGG - Intronic
1084488721 11:69466009-69466031 CCCACCCACATTATTTTTTGAGG - Intergenic
1085739105 11:79064076-79064098 CTCACATACTTATTTTTTTGTGG + Intronic
1086644423 11:89202182-89202204 CCCACACACTTATTTTTGTGGGG + Intronic
1087042668 11:93817162-93817184 AATACCCACTTAATTTTTAAAGG + Intergenic
1088119093 11:106347140-106347162 CTCACATACTTATTTTTTTGTGG + Intergenic
1088210921 11:107455176-107455198 CTCATCAACTTATTTTTTTGTGG - Intronic
1089193640 11:116677241-116677263 CACACCCAGCTAAATTTTTTTGG - Intergenic
1089514134 11:119020860-119020882 CACACCCAGCTAATTTTTTGTGG + Intronic
1089751223 11:120652598-120652620 CACATCCATTTTTTTTTTTGAGG + Intronic
1090798167 11:130153335-130153357 CACGCCCAGCTAACTTTTTGGGG - Intergenic
1090916129 11:131164644-131164666 CTCACCTACTTATTTTTTTGTGG + Intergenic
1091988294 12:4932196-4932218 CACACTCACTCATTTTCTTGTGG + Intergenic
1092180344 12:6442616-6442638 CACAACCACTTTCTCTTTTGGGG - Intergenic
1093206454 12:16257105-16257127 CACACCCACATATGTGTTTGTGG - Intronic
1093406327 12:18809492-18809514 CACGCCCGGCTAATTTTTTGTGG + Intergenic
1095456908 12:42396881-42396903 CATGCCCAGCTAATTTTTTGTGG - Intronic
1096315321 12:50559574-50559596 CACACCTGGCTAATTTTTTGTGG - Intronic
1096328958 12:50692295-50692317 CACACCAACTTTTTTTTTTTAGG + Intronic
1097099826 12:56579474-56579496 CACACCCGGCTAATTTTTTTTGG - Intronic
1097123568 12:56754878-56754900 CACACCCTGTTAATTTTTCTGGG - Intronic
1098555897 12:71818443-71818465 CTCACATACTTATTTTTTTGTGG - Intergenic
1098712830 12:73787506-73787528 TACACCTGCTTAACTTTTTGAGG + Intergenic
1100315232 12:93439319-93439341 CACACCCAGCTAATTTTTGTAGG - Intronic
1100414360 12:94356390-94356412 CACCCCCTCATTATTTTTTGAGG + Intronic
1100551843 12:95653297-95653319 CACACCCAGCTAATTTTTTGTGG + Intergenic
1100662023 12:96709875-96709897 CACGCCCAGCTAATTTTTTGTGG + Intronic
1101844737 12:108353774-108353796 CATGCCCAGTTAATTTTTTATGG + Intergenic
1101904217 12:108813194-108813216 CCCACCCACTTTATCCTTTGGGG - Intronic
1101905496 12:108822180-108822202 CACAGCCAGCTAGTTTTTTGTGG - Intronic
1103501271 12:121404541-121404563 CACACCCAGCTAATTTTTTTTGG + Intronic
1103774403 12:123355624-123355646 TGCACCCAGCTAATTTTTTGAGG - Intronic
1105983104 13:25539047-25539069 CACACACACTAAATTTTCTAAGG - Intronic
1107177780 13:37419909-37419931 CTCCCCAACTTATTTTTTTGTGG - Intergenic
1107605776 13:42054748-42054770 CTCACATACTTAATTTTTTGTGG - Intronic
1108251561 13:48572892-48572914 CACACACACTTTTTTTTTTTTGG - Intergenic
1109791013 13:67247515-67247537 CAAACCCACTGAACTTTTAGGGG - Intergenic
1110584687 13:77175083-77175105 CACACTCAGTTAATTTTTTAGGG + Intronic
1111024942 13:82508984-82509006 CACACCTGGCTAATTTTTTGTGG - Intergenic
1111453754 13:88453078-88453100 CACACCCGGCTAATTTTTTTTGG + Intergenic
1111800075 13:92970339-92970361 CACACTCACTTAATTCTTCCTGG - Intergenic
1112011257 13:95295663-95295685 GACACCTAGCTAATTTTTTGAGG - Intronic
1112522130 13:100105683-100105705 CACACCCAGCTAATTTTTGTGGG - Intronic
1115169119 14:30483419-30483441 CACAGCCACTTTATTTTTCATGG - Intergenic
1115180339 14:30618492-30618514 CACACACACATACTTTGTTGGGG + Exonic
1115231286 14:31163444-31163466 CACGCCCAGCTAATTCTTTGGGG - Intronic
1115716253 14:36107299-36107321 GATACACATTTAATTTTTTGCGG - Intergenic
1116644185 14:47505367-47505389 CTCACGCAGTTATTTTTTTGCGG - Intronic
1116787972 14:49309061-49309083 CACACCCTCTCATTCTTTTGAGG - Intergenic
1117682257 14:58216279-58216301 CACACCCAGCTAATTTTTGGGGG + Intronic
1118123464 14:62872534-62872556 CACGCCCAGCTAATTTTTTTTGG - Intronic
1118574683 14:67230413-67230435 CATACCCAGCTTATTTTTTGTGG - Intergenic
1121552697 14:94814284-94814306 CCCACCCACATATTATTTTGGGG - Intergenic
1121993753 14:98585628-98585650 CACCCCCACTTAGCTTTTGGAGG + Intergenic
1124108596 15:26764971-26764993 CACACCCAGCTAACTTTTTGTGG - Intronic
1124158079 15:27245714-27245736 CATGCCCAGCTAATTTTTTGTGG - Intronic
1124407864 15:29407820-29407842 CACACCCCACTAATTTTTTGGGG + Intronic
1124477733 15:30049507-30049529 CACACCCAGCAAATTTTTTTTGG + Intergenic
1125898869 15:43326989-43327011 CAAAGCCACTACATTTTTTGAGG + Exonic
1126431443 15:48589442-48589464 CACACACACTCGTTTTTTTGTGG - Intronic
1126557255 15:50003366-50003388 CAAACCCACTTATTCTTTTAGGG - Intronic
1126622584 15:50654842-50654864 CACACCCGGGTAGTTTTTTGTGG - Intronic
1127340502 15:58038402-58038424 CACACCCAAATAATTTTTAAGGG + Intronic
1128169552 15:65499057-65499079 CACACACACTTTTTTTTTGGGGG - Intronic
1130628969 15:85546193-85546215 CTCAGCTACTTATTTTTTTGTGG - Intronic
1132173516 15:99688598-99688620 CACGCCCGGCTAATTTTTTGTGG - Intronic
1133630776 16:7618642-7618664 TACACCAACTTAATTTGTTGGGG - Intronic
1134087522 16:11368309-11368331 GACACCCAGCTAATTTTTTTTGG + Intronic
1134491212 16:14696831-14696853 CATGCCCAGCTAATTTTTTGTGG - Intergenic
1134496593 16:14735949-14735971 CATGCCCAGCTAATTTTTTGTGG - Intronic
1135166342 16:20142477-20142499 CACACACACACAATTTTTTGTGG + Intergenic
1137375205 16:47946488-47946510 TAAAACCACTCAATTTTTTGAGG - Intergenic
1137998602 16:53248680-53248702 CACACCCAGCTAATTTATTTTGG + Intronic
1138356423 16:56384729-56384751 CACACACACTCAATTTTTGGAGG + Intronic
1139395666 16:66636920-66636942 AACACCCACTTACTTATTGGTGG - Intronic
1139519628 16:67473503-67473525 TACGCCCAACTAATTTTTTGTGG + Intronic
1139571739 16:67817120-67817142 CACACCTGGCTAATTTTTTGCGG + Intronic
1139575496 16:67839401-67839423 CACACCCAGCTAATTTTTTTTGG - Intronic
1139626493 16:68193510-68193532 CACACCCAGCTAATTTTTGTAGG - Intronic
1139697684 16:68686809-68686831 CACACCCAGCTTATTTTTTTTGG - Intronic
1139821448 16:69724543-69724565 CACACCCAGCTAATTTTTTTTGG - Intronic
1140007251 16:71090654-71090676 CACACCCAACTAATTTTTGTGGG + Intronic
1140047362 16:71450560-71450582 CACACCCGGCTAATTTTTTGTGG - Intronic
1140137355 16:72219110-72219132 CTCACATACTTATTTTTTTGTGG + Intergenic
1140692893 16:77501302-77501324 TACACCCACTTTATTGTGTGTGG - Intergenic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1143583929 17:7842164-7842186 CACACCCACTTAACTCTCTCTGG - Intronic
1143819451 17:9547945-9547967 CACACCCAGCTAATTTTTGTGGG + Intronic
1143953308 17:10650685-10650707 CTCACATACTTATTTTTTTGTGG + Intronic
1144130032 17:12238024-12238046 CACGCCCAGCTAATTTTTGGGGG - Intergenic
1144463347 17:15476533-15476555 CTCACCAACTTACATTTTTGTGG + Intronic
1146999393 17:37350361-37350383 CACACCCAGCTAATTTTTTCTGG - Intronic
1147610701 17:41800414-41800436 CACACCTGGCTAATTTTTTGGGG - Intergenic
1147801679 17:43095423-43095445 CACACCCGGTTAATTTTTTGTGG - Intronic
1147835432 17:43327322-43327344 CATACCCACTTTCCTTTTTGTGG + Intergenic
1148004709 17:44417369-44417391 CACATCCAGCTAATTTTTGGGGG + Intronic
1148432841 17:47656389-47656411 CACACCCAGCTAACTTTTTTGGG - Intronic
1148832273 17:50441325-50441347 CACACCCAGCTAAATTTTTTTGG + Intronic
1149019463 17:51946305-51946327 CTCACACACTTATTTTTTTGTGG - Intronic
1149262594 17:54896276-54896298 CACAGCAACTTAAGATTTTGAGG + Intergenic
1149411334 17:56410510-56410532 CTCACCAACTTATTGTTTTGTGG + Intronic
1149529102 17:57380636-57380658 CACATCCACTTGGTTGTTTGGGG - Intronic
1149587703 17:57803890-57803912 CACGCCCAGCTAATTTTTTTGGG + Intergenic
1149674733 17:58449541-58449563 CACACCCAGCTAATTTTTGCAGG - Intronic
1150093508 17:62351579-62351601 CACACCCAGCTAATTTTTGTGGG + Intergenic
1150349246 17:64430023-64430045 CACACCCAACTAATTTTTGTGGG + Intergenic
1151278915 17:73057105-73057127 CATGCCCAGTTAATTTTTTGTGG + Intronic
1152607881 17:81302199-81302221 CACACCCGGCTAATTTTGTGGGG + Intergenic
1153005335 18:493229-493251 CGCACCCATTAAATTTTCTGTGG + Intronic
1153638739 18:7136559-7136581 CACGCCCGGTTAATTTTTTTTGG + Intergenic
1153763544 18:8354054-8354076 CACGCCCAGCTAATTTTTTGTGG - Intronic
1154056615 18:11018805-11018827 CATACCCACATATCTTTTTGAGG + Intronic
1154345676 18:13541917-13541939 CACACCCCACTAATTTTTTTGGG - Intronic
1155352483 18:24920070-24920092 CACACCCAGCTAATTTTGTGGGG - Intergenic
1155574940 18:27234399-27234421 AACACCCAGCTAATTTTTTGTGG + Intergenic
1155809483 18:30213959-30213981 TACAGCCTCTTAATTTTCTGTGG + Intergenic
1156607667 18:38686707-38686729 CACACCCACATAATGTTTGGAGG + Intergenic
1157268891 18:46254376-46254398 CACACCAACTTGATGTCTTGTGG - Intronic
1158032904 18:52988793-52988815 CACACACATGTAATTTTTTGTGG + Intronic
1158762203 18:60403210-60403232 CACACCCAGTTTATTTTGTAAGG + Intergenic
1158970159 18:62658774-62658796 CACACCCAGCTAATTTTTTGAGG - Intergenic
1159191028 18:65042894-65042916 CACGTCCAGCTAATTTTTTGGGG + Intergenic
1160456424 18:79005603-79005625 CACACCCTGCTAATTTTTTGGGG + Intergenic
1160973022 19:1778253-1778275 CATGCCCATTTAATTTTTTAAGG + Exonic
1161272308 19:3396797-3396819 CACACCCAGCTAATTTTTGTAGG - Intronic
1161477541 19:4494759-4494781 CACGCCCAGCTAATTTTTTAAGG - Intronic
1161742227 19:6028920-6028942 CACACCCACCTAATTTTTTTTGG - Intronic
1162648480 19:12067041-12067063 CACACCCAGCTAATTTTTTATGG - Intronic
1162662528 19:12181627-12181649 CACGCCCAGCTAATTTTTTTTGG + Intronic
1162839908 19:13348849-13348871 CACACCCAGCTAATTTTGGGGGG - Intronic
1163760050 19:19131521-19131543 CACACACACACAATTTTTTGGGG + Intronic
1163933710 19:20422998-20423020 CACACCCGGCTAATTTTGTGTGG - Intergenic
1164275788 19:23716672-23716694 CACGCCCAGTTAATTTTTTGTGG - Intergenic
1164449123 19:28344786-28344808 CACACCTACTTAAAATTTTTAGG + Intergenic
1166452308 19:42912716-42912738 CACACAAACTTAAATTTTAGTGG - Intronic
1166491429 19:43264014-43264036 CACACAGACTTAAATTTTAGTGG - Intronic
1166525773 19:43508642-43508664 CTCAAACACTTAATTTTTTTTGG + Intronic
1166757911 19:45205156-45205178 CACACACACACAATTTCTTGTGG - Intronic
1167750571 19:51377185-51377207 CACTCCCAGCTAATTTTTTGGGG - Intergenic
1167892090 19:52548577-52548599 CACACCCGGGTAATTTTTGGTGG + Intronic
1167947428 19:52999984-53000006 CACATCCAGCTAATTTTTAGTGG - Intergenic
1168428162 19:56256347-56256369 CACACCCGGCTAATCTTTTGTGG + Intronic
925567512 2:5272155-5272177 CCCACCCACTTTATCTTTTGGGG - Intergenic
926180252 2:10636449-10636471 CACACCCAGCTAATTTTGTTTGG - Intronic
927402243 2:22725764-22725786 CTCACCAACTCATTTTTTTGTGG - Intergenic
927724197 2:25408380-25408402 CACACCCAACTAATTTTTGTTGG - Intronic
928037070 2:27834638-27834660 CACACTCACTTAAACTTTTTAGG + Intronic
928508875 2:31983102-31983124 CACACCCAGCTAATTTTTGTGGG - Intronic
928942504 2:36740943-36740965 CAGACCAACTAAATATTTTGGGG - Intronic
928966749 2:36983569-36983591 CACACCCAGCTAATATTTTTGGG - Intronic
929126692 2:38529143-38529165 CACACCCAGCAAATTTTTTTTGG + Intergenic
931329665 2:61267597-61267619 TACACCCAGCTAATTTTTTGTGG + Intronic
932548481 2:72741100-72741122 CACCCCCCCTTTTTTTTTTGAGG - Intronic
932962333 2:76428190-76428212 CACTCCCACTTAAATATCTGGGG - Intergenic
933506906 2:83188257-83188279 CACACACACATACTTTTTTAAGG - Intergenic
935155576 2:100480946-100480968 CAGACCCACTGAATCTTTGGGGG - Intronic
935632839 2:105226074-105226096 CACACCCAGCTAATTTTTGTGGG - Intergenic
935858624 2:107302659-107302681 CACACCCAGCTAATTTTTTTTGG - Intergenic
937388146 2:121456078-121456100 CTCACATACTTATTTTTTTGTGG - Intronic
937650355 2:124312519-124312541 CACACCCAACTAATTTTTGTGGG + Intronic
938398818 2:130970736-130970758 CAGACCCACATAATTTTTATTGG + Intronic
938937106 2:136136782-136136804 CACACATACTATATTTTTTGAGG + Intergenic
940212643 2:151271552-151271574 CACAACAACTTTATTTTTTGTGG + Intronic
940229111 2:151431320-151431342 CACATCCACTTAAATTTTACTGG + Intronic
941515018 2:166462905-166462927 CTCACATACTTATTTTTTTGTGG + Intronic
942345438 2:174997841-174997863 CACACCCAGCTAATTTTTGTTGG - Intronic
943948712 2:194101221-194101243 TACACCCACTTATTTTTTCATGG - Intergenic
943985238 2:194610406-194610428 AACAACCATTTAATTTTTTTAGG - Intergenic
944150310 2:196551260-196551282 CACACCCACTTCATTTTATTAGG + Intronic
944315294 2:198278230-198278252 CACACACACTTAAAAGTTTGAGG + Intronic
945100890 2:206261349-206261371 CTCAACCTCTTAATGTTTTGGGG - Intergenic
945285848 2:208080637-208080659 CACACCTGGCTAATTTTTTGTGG - Intergenic
945313853 2:208348586-208348608 CACACACACTTTTTTTTTTTTGG - Intronic
945913651 2:215679611-215679633 CTCACATACTTATTTTTTTGAGG - Intergenic
945949014 2:216021302-216021324 CACACCCAGCTAATATTTTGGGG + Intronic
946288706 2:218726620-218726642 CACATCCAGCTAATTTTTTCTGG + Intronic
946301263 2:218825489-218825511 CACGCCCAGCTAATTTTTGGGGG - Intronic
946906609 2:224422846-224422868 CATGCCCAGCTAATTTTTTGGGG - Intergenic
1168791829 20:582817-582839 CACACCCGGTTAATTTTTTTTGG - Intergenic
1169076705 20:2764443-2764465 CACACCCAGCTAATTTTTTAGGG + Intergenic
1169295668 20:4395627-4395649 CTCACCAACTTATTTTTTTATGG + Intergenic
1169396301 20:5233030-5233052 CACACCCAGCTTATTTTTTTTGG - Intergenic
1169951887 20:11053856-11053878 CTCACCAACATACTTTTTTGTGG - Intergenic
1170083344 20:12501275-12501297 CCCACCCACTTTATTTTCTAGGG + Intergenic
1170100012 20:12688523-12688545 AATACCAACTCAATTTTTTGTGG + Intergenic
1170502784 20:16991891-16991913 CTCAACTACTTATTTTTTTGTGG + Intergenic
1172373324 20:34414621-34414643 CACGCCCAGCTAATTTTGTGGGG + Intronic
1172710793 20:36921678-36921700 CACACCCAGCTAATTTTTTGTGG + Intronic
1173614647 20:44394825-44394847 CATGCCCAGTTAATTTTTTAAGG + Intronic
1174009753 20:47440012-47440034 CACGCCCAGTTAATTTTGTATGG - Intergenic
1178290557 21:31364465-31364487 CACACCCACTTCAGTTGCTGGGG - Intronic
1178643329 21:34364163-34364185 CACACATTCTTTATTTTTTGAGG + Intronic
1178974796 21:37212236-37212258 CCAACTCACTTATTTTTTTGTGG + Intergenic
1179125413 21:38586279-38586301 CTCACATACTTATTTTTTTGTGG + Intronic
1179541767 21:42087553-42087575 CACATCCAATTATTTTTCTGAGG - Intronic
1181080199 22:20409089-20409111 CACGCCCAGCTAAATTTTTGGGG + Intergenic
1181309369 22:21936014-21936036 CACACACAGCTAATTTTTTTTGG - Intronic
1181757126 22:25032016-25032038 CACACCCTCTTCCCTTTTTGAGG + Intronic
1182634891 22:31718226-31718248 CCCGCCCAGCTAATTTTTTGGGG + Intronic
1182760221 22:32716685-32716707 CATACCCGGCTAATTTTTTGTGG + Intronic
1183132681 22:35854428-35854450 CATACCCAGCTAATTTTTTTGGG - Intronic
1183813218 22:40275800-40275822 CACACCCAGCTAATTTTTGTAGG - Intronic
1185287217 22:50007525-50007547 CACACTCAGTTAATTTTTTTGGG + Intronic
1185294860 22:50048106-50048128 CACACACACACACTTTTTTGGGG - Intronic
949383967 3:3479236-3479258 CACAGACAAATAATTTTTTGAGG + Intergenic
951222904 3:20087487-20087509 CACATACTTTTAATTTTTTGTGG + Intronic
951333618 3:21394804-21394826 CACACCGAGCTAATTTTTTGTGG + Intergenic
951402836 3:22255416-22255438 TACACACACTTAACATTTTGGGG + Intronic
952389491 3:32867706-32867728 CTCACATACTTATTTTTTTGTGG + Intronic
952456726 3:33479496-33479518 CACACCCAGCTAATTTTTTGAGG + Intergenic
953560048 3:43981370-43981392 CTCAAATACTTAATTTTTTGTGG + Intergenic
953801457 3:46027035-46027057 CACACCTAGCTAATTTTTTGGGG + Intronic
953887909 3:46728196-46728218 CACGCCCGGTTAATTTTTTTGGG + Intronic
954883846 3:53854958-53854980 CACGCCCGGCTAATTTTTTGTGG - Intronic
956705598 3:71996330-71996352 CACACCCTCTAAAATATTTGAGG + Intergenic
957368287 3:79255671-79255693 CACACACACATAATATTTTGTGG + Intronic
959284885 3:104396082-104396104 CTCACATACTTATTTTTTTGTGG + Intergenic
959748670 3:109807696-109807718 CACACCCAGCTAATTTTTTTTGG - Intergenic
959966043 3:112356467-112356489 CTCACATACTTATTTTTTTGTGG + Intronic
960163185 3:114372686-114372708 CACAGCCAGCTAGTTTTTTGGGG - Intronic
960809598 3:121615046-121615068 CACACCCAGCAAACTTTTTGTGG - Intronic
961139011 3:124539902-124539924 CACACCAAGCTAATTTTTTTTGG + Intronic
962406559 3:135105630-135105652 CACATCCTCTTAATTTCCTGTGG - Intronic
962573596 3:136735767-136735789 CACGCCCAGCTAATTTTTTCTGG + Intronic
962578724 3:136778083-136778105 CATGCCCAGCTAATTTTTTGTGG - Intergenic
962623966 3:137206797-137206819 CACATCCAATTAATTTTTGGTGG + Intergenic
962771698 3:138616529-138616551 CACACCCAGCTAATTTTTTTTGG + Intronic
963302620 3:143616035-143616057 CACGCCCAGCTAATTTTTTTTGG + Intronic
963716097 3:148805538-148805560 CACGCCCGGCTAATTTTTTGTGG - Intronic
964341760 3:155715767-155715789 CATGCCCAGCTAATTTTTTGTGG + Intronic
966716143 3:183014868-183014890 TACACCCAGCTTATTTTTTGTGG + Intergenic
967032885 3:185624709-185624731 CAGACCCAGTTAATTTTTAGTGG - Intronic
967148893 3:186630202-186630224 CACACCCAGCTAATTTTTGTGGG + Intergenic
967200893 3:187071602-187071624 CACGCCCGGCTAATTTTTTGGGG - Intronic
967768031 3:193303914-193303936 CACACACACATAATTTTTGCTGG + Intronic
968095073 3:195923636-195923658 CACAACCGATTAATTTTTTTTGG + Intergenic
969071912 4:4546547-4546569 CATGCCCAGCTAATTTTTTGGGG + Intergenic
969365503 4:6691853-6691875 CACACCAGGCTAATTTTTTGGGG - Intergenic
969686036 4:8674773-8674795 CACACCCACTTCATCTTATCTGG - Intergenic
970618483 4:17791585-17791607 CACACCCAGCTAATTTTTGTAGG - Intergenic
972392007 4:38622648-38622670 CACACCTGGCTAATTTTTTGTGG + Intergenic
972709029 4:41575049-41575071 CACACACACACAATTTATTGAGG + Intronic
972883422 4:43454771-43454793 CTCACCAACTTATTTTCTTGTGG + Intergenic
973947812 4:55977657-55977679 CTCACCAACTTATTTTTTTGTGG + Intronic
974514649 4:62894053-62894075 CACACACACAATATTTTTTGTGG + Intergenic
975362662 4:73489480-73489502 CTCACATACTTATTTTTTTGTGG + Intronic
975473692 4:74797637-74797659 CACACCCAGCTAATTTTTTGTGG + Intergenic
975540052 4:75499982-75500004 CATGCCCAGCTAATTTTTTGTGG - Intronic
976207069 4:82632967-82632989 CTCACACACTTATGTTTTTGTGG + Intronic
976612913 4:87048047-87048069 CAGACCCAGTTAATTTTTCCTGG + Intronic
976835898 4:89373310-89373332 CACACACATTACATTTTTTGTGG + Intergenic
980072205 4:128255193-128255215 CACACACACGTAATTAATTGTGG + Intergenic
980102684 4:128557411-128557433 CACACTCAGCTAATTTTTTCTGG + Intergenic
980487717 4:133480938-133480960 CTAACCCATTTAATATTTTGTGG + Intergenic
981456999 4:144964238-144964260 CACATACATTTTATTTTTTGTGG - Intergenic
981601334 4:146492061-146492083 CACGCCCAGCTAATTTTTTTTGG - Intronic
981998756 4:151002855-151002877 TACACCCAGCTAATTTTTTGGGG - Intronic
984304691 4:177973462-177973484 CACGCCCGGTTAATTTTTTTTGG + Intronic
985272564 4:188207912-188207934 CACACACACACACTTTTTTGTGG - Intergenic
986333944 5:6738928-6738950 CTCTCACACTTAATTTGTTGGGG + Intronic
987208512 5:15653627-15653649 CAAAACCACTTAAGCTTTTGAGG + Intronic
987553495 5:19414525-19414547 CACACACACCTTATTTTATGAGG - Intergenic
987592734 5:19952204-19952226 CACACCTGGCTAATTTTTTGTGG + Intronic
987676094 5:21074218-21074240 CAAACCAACTTTATTTTTTAAGG + Intergenic
987985667 5:25142285-25142307 CACGCCCAGCTAATTTTTAGTGG + Intergenic
988921827 5:35949359-35949381 CACGCCTGGTTAATTTTTTGTGG + Intergenic
991454624 5:66789214-66789236 CATACACACATGATTTTTTGAGG + Intronic
992113127 5:73514789-73514811 CACACCCAGCTAATTTATTTTGG - Intergenic
992906626 5:81352871-81352893 CACACACACTTCAATTTCTGTGG - Intronic
993273773 5:85830235-85830257 CACACCCAGTTAATTTTTGTGGG + Intergenic
993277151 5:85874672-85874694 CACACCCACAGAATTTACTGTGG + Intergenic
996918302 5:128736569-128736591 CACACCCACTTTCTTTTTAAAGG + Intronic
997948823 5:138225545-138225567 CAAGCCCAGATAATTTTTTGAGG + Intergenic
998508570 5:142692178-142692200 CACACCCAGCTAATTTTTGTGGG - Intronic
999051865 5:148531604-148531626 CAAACCCACTTAATTTTTCTAGG + Intronic
999061329 5:148638888-148638910 CACGCCCATCTAATTTTTTGTGG - Intronic
999682656 5:154074564-154074586 CACACCCAGCTAATTGTGTGGGG + Intronic
999754883 5:154656940-154656962 CACACCCAGCTAATTTTTTTTGG - Intergenic
999831100 5:155320998-155321020 CATGCCCAGCTAATTTTTTGTGG + Intergenic
1000170101 5:158693987-158694009 CACGCCCAGCTAATTTTTTTTGG + Intergenic
1001962621 5:175889116-175889138 CACACTCAACTAATATTTTGGGG - Intergenic
1001978201 5:176018177-176018199 CACATCCAGCTAATTTTTAGGGG + Intronic
1002150036 5:177221018-177221040 CACCCCCGGTTAATTTTGTGTGG + Intronic
1002239218 5:177825585-177825607 CACATCCAGCTAATTTTTAGGGG - Intergenic
1002592044 5:180297283-180297305 CACACCCGGCTAATTTTTTTTGG - Intergenic
1002870906 6:1166582-1166604 CATACCCCCTTAAATATTTGAGG - Intergenic
1003923782 6:10857907-10857929 CACACCCACTTAATTAGCTGTGG - Intronic
1004313663 6:14567513-14567535 CACGCCCAGCTAATTTTTTTCGG - Intergenic
1004420759 6:15467677-15467699 CACACCCAGCTAATTTTTTGTGG - Intronic
1006142543 6:31938952-31938974 CACACCTGGCTAATTTTTTGTGG + Intronic
1007153950 6:39724294-39724316 CACGCCCGGTTAATTTTTTGTGG - Intronic
1007883390 6:45193557-45193579 CATGCCCAGCTAATTTTTTGAGG - Intronic
1009556442 6:65176050-65176072 AACACACACTTAATTATGTGAGG - Intronic
1009563646 6:65280018-65280040 AGCAACCACTTATTTTTTTGTGG + Intronic
1009607014 6:65884086-65884108 CTTACCAACTTATTTTTTTGTGG + Intergenic
1009955657 6:70449230-70449252 CTCACCTACTTTTTTTTTTGTGG + Intronic
1010437350 6:75849191-75849213 CACACCCACTCATTTATGTGTGG + Intronic
1011741164 6:90362103-90362125 CACACCCAGCTAATTTTTTGGGG - Intergenic
1012358709 6:98349414-98349436 CACACCCGTCTAATTTTTTGTGG - Intergenic
1013530395 6:111014287-111014309 CACACCTGGCTAATTTTTTGTGG + Intronic
1013855570 6:114567937-114567959 CACACCCATTTCCTTTTTTGAGG - Intergenic
1014189965 6:118484157-118484179 CACGCCCAGCTAATTTTTTTGGG - Intronic
1014339266 6:120182434-120182456 CTCACATACTTATTTTTTTGGGG + Intergenic
1014917848 6:127174656-127174678 CACATACACTTAAATCTTTGAGG - Intronic
1015069360 6:129071996-129072018 CACACCCAGCTAATTTGTTTTGG - Intronic
1015448006 6:133330584-133330606 CACACACACATACTTTTTTGGGG + Intronic
1015586544 6:134782433-134782455 CACACCCGGCTAATTTTTTTGGG - Intergenic
1015692650 6:135942470-135942492 CTCACATACTTAATGTTTTGTGG + Intronic
1017804897 6:157936350-157936372 TACACCCAGCTAATTTTTGGGGG - Intronic
1019584492 7:1790483-1790505 CACGCCCAGCTCATTTTTTGGGG - Intergenic
1019991645 7:4695957-4695979 CACACCCAGCTAATTTTTGTGGG - Intronic
1020069616 7:5217775-5217797 CAAACCCACTTGATTTACTGGGG - Intronic
1020463081 7:8445030-8445052 CCCACCCTCTTCATTTTTAGAGG + Intronic
1021729715 7:23584690-23584712 TACGCCCAACTAATTTTTTGGGG + Intergenic
1022408126 7:30111774-30111796 CACACCCAGCTAATTTTGTATGG + Intronic
1022682847 7:32566331-32566353 CACGCCCAGCTAATTTTTTGTGG + Intronic
1022976859 7:35566681-35566703 CACACATATTTAATTTTTTGAGG - Intergenic
1023490105 7:40730525-40730547 CTCACATACTTATTTTTTTGTGG + Intronic
1023523817 7:41077787-41077809 CACACACACTTGATTATTTCTGG + Intergenic
1024157819 7:46643333-46643355 CACACCCAGCTAATTTTTTGTGG + Intergenic
1024606143 7:51024150-51024172 CACGCCCGGCTAATTTTTTGTGG - Intronic
1025922788 7:65929254-65929276 CACACCCAGCTAATTTTTTTTGG - Intronic
1025974070 7:66355746-66355768 CACACCCAGCTAATTTTTTTTGG - Intronic
1026182041 7:68050085-68050107 CATGCCCACTTAATTTTTTGGGG - Intergenic
1026656911 7:72264656-72264678 CACACCCAGCTGATTTTTTGTGG + Intronic
1026814233 7:73497084-73497106 CACACCCAGCTAATTTTTGTAGG - Intronic
1027527556 7:79289303-79289325 CCCTCCCAGTTAATTTTTAGTGG - Intronic
1027646685 7:80810100-80810122 CTCGCCCACGTATTTTTTTGTGG - Intronic
1028548908 7:92034655-92034677 CACACCCAGCTAATTTTTGTGGG + Intronic
1029691572 7:102185574-102185596 CACACCCAGCTAATGTTTTGGGG + Intronic
1030071654 7:105703145-105703167 CACGCCCAGCTAATTTTTTGGGG - Intronic
1030564618 7:111137979-111138001 CACACCCAGCTAATTTTTGTGGG + Intronic
1030897519 7:115079333-115079355 CACACACACACAATTTTTTCTGG + Intergenic
1031443754 7:121825734-121825756 CACACCCGGCTAATTTTTTTTGG + Intergenic
1031791572 7:126112573-126112595 CACATCATTTTAATTTTTTGAGG - Intergenic
1032111411 7:129079065-129079087 CACACACAGCTAATTTTTTAAGG - Intergenic
1032588713 7:133172578-133172600 CAGACCCATTTAAATCTTTGAGG + Intergenic
1032657535 7:133947745-133947767 AACAGCCACATAATTTTTTATGG - Intronic
1032905660 7:136361524-136361546 CACACCTGGCTAATTTTTTGTGG + Intergenic
1033373767 7:140736891-140736913 CACACCCAGCTAATTTCTTGTGG - Intronic
1033391744 7:140935521-140935543 CACAATGACTTTATTTTTTGAGG - Intergenic
1033556052 7:142489289-142489311 CACACCCAGCTAATTCTTTTTGG + Intergenic
1034458206 7:151183243-151183265 CATTCCCAGCTAATTTTTTGTGG - Intronic
1034696255 7:153056568-153056590 CACAGGCATTTAATTTTTTATGG + Intergenic
1035215065 7:157359660-157359682 CACACCCAACTATTTTTTTTTGG - Intronic
1035450138 7:158972682-158972704 CACGCCCAGCTAATTTTTTGTGG + Intergenic
1035707344 8:1686886-1686908 CACACACACATAAATGTTTGAGG + Intronic
1036144619 8:6243516-6243538 CATACCCAGCTAATTTTCTGTGG - Intergenic
1036155714 8:6340159-6340181 TAAACCCACTGAATTTTTTGAGG + Intergenic
1036164830 8:6422843-6422865 CACGCCCGGCTAATTTTTTGTGG + Intronic
1036237977 8:7058234-7058256 CTCACCAACTTAATTTTTTAAGG + Intergenic
1036615551 8:10384843-10384865 AACACCCAGCTAATTTTTTTTGG - Intronic
1037028895 8:14076678-14076700 CACACACCCTTAGTTTCTTGGGG - Intergenic
1037295162 8:17391838-17391860 AACCCCCACTTAATGTTTTGTGG - Intronic
1038341173 8:26686386-26686408 CACACACACTTATTTTCTTGTGG + Intergenic
1039706140 8:40009402-40009424 CACACACATTCAATTTCTTGAGG + Intronic
1040122386 8:43697599-43697621 CACACTCATTAAATATTTTGTGG - Intergenic
1040279723 8:46033386-46033408 CACACCCACTTATGTGTGTGAGG - Intergenic
1040770002 8:50962337-50962359 CACACACACATAATTTTTTAAGG + Intergenic
1041896922 8:62935761-62935783 CATATCCACTTAAATTTTAGTGG - Intronic
1042109323 8:65363220-65363242 CACATCACCTTACTTTTTTGTGG - Intergenic
1042717506 8:71790546-71790568 CACACCCCGCTAATTTTTTGTGG - Intergenic
1044777341 8:95704581-95704603 ATCACCTACTTATTTTTTTGTGG + Intergenic
1045018068 8:98016214-98016236 CACACCAGGCTAATTTTTTGTGG - Intronic
1045089362 8:98724527-98724549 CACACCCACATATTTTTAAGTGG + Intronic
1045220073 8:100190154-100190176 CACATCCAGCTAATTTTTTTTGG - Intronic
1046534285 8:115488516-115488538 CACGCCCAGCTAATTTTTTGGGG - Intronic
1046665369 8:116996472-116996494 CTCACATACTTATTTTTTTGTGG + Intronic
1047395316 8:124492478-124492500 CACACCCAGCCAATTTTTTGGGG - Intronic
1048338547 8:133521288-133521310 CACACCCAGCTAATTTTTGGGGG + Intronic
1048652794 8:136498011-136498033 CACACCCAGCTAAATTTTTAGGG - Intergenic
1048777540 8:137963965-137963987 CACGCCCAGCTAATTTTTTGTGG - Intergenic
1049059097 8:140262261-140262283 AACTCCCACTTAGTTGTTTGGGG - Intronic
1050348445 9:4716623-4716645 CAAACCATCTTAATTTTTTCTGG - Intronic
1050708243 9:8428663-8428685 CACACACACACAATTTTTTTTGG - Intronic
1051641442 9:19228551-19228573 CACACCCCACTAATTTTTTGGGG - Intergenic
1052951659 9:34218301-34218323 CACATCCATTTAAATTTTGGTGG + Intronic
1053119156 9:35532587-35532609 CACACCCAGCTATATTTTTGTGG - Intronic
1053611337 9:39716135-39716157 CACACCCGGCTAATTTTTTTAGG + Intergenic
1054086917 9:60755025-60755047 CACACCCGGCTAATTTTTTTAGG - Intergenic
1054242183 9:62626257-62626279 CACACCCGGCTAATTTTTTTAGG - Intergenic
1054556308 9:66660773-66660795 CACACCCAGCTAATTTTTTTAGG - Intergenic
1054751486 9:68911724-68911746 CACACCTGACTAATTTTTTGTGG - Intronic
1054849146 9:69828524-69828546 CACACCCGGCTAATTTTTGGTGG - Intronic
1055018127 9:71641175-71641197 CACACCCAGCTAATTTTTGTAGG - Intergenic
1055279660 9:74659645-74659667 CACACCTGGCTAATTTTTTGTGG + Intronic
1058454076 9:105123159-105123181 CACACCCAGCTAATTTTTGGTGG - Intergenic
1058987300 9:110220203-110220225 CACACCCAGCTAATTTTTTGTGG - Intergenic
1059173453 9:112148306-112148328 CAAACCCTCCTAATTTTTAGCGG - Intronic
1059226367 9:112676545-112676567 CACACCTGGATAATTTTTTGTGG - Intergenic
1059914700 9:119085971-119085993 CACACCCAGCTAATTTTTGTGGG - Intergenic
1060460204 9:123845511-123845533 CACACCCACTTAATTTTTTGGGG - Intronic
1061128418 9:128690416-128690438 CACACCCACTTAGCTTTGTAGGG + Intronic
1061562312 9:131413530-131413552 CACACCCAGCTAATTTTTAGTGG + Intronic
1061716815 9:132523508-132523530 CACAGCCACTTCATTCTTTTTGG + Intronic
1061870819 9:133519401-133519423 GACACCCACCGAATTTTTTGTGG - Intronic
1186016797 X:5204755-5204777 CACACACACGTAATTCTGTGAGG - Intergenic
1186282723 X:8010914-8010936 CTCACATACTTATTTTTTTGTGG + Intergenic
1187233810 X:17447421-17447443 AATTCCCACTTAATTTCTTGTGG - Intronic
1187287008 X:17915351-17915373 AATGCCCACTTAATGTTTTGTGG - Intergenic
1187523727 X:20035754-20035776 CACACCCACCTAATTTTTTGTGG - Intronic
1188117874 X:26267430-26267452 CACACCCAGCTAATTGTTTTTGG - Intergenic
1188255140 X:27953104-27953126 CTCACATACTTATTTTTTTGTGG + Intergenic
1190158819 X:48015862-48015884 CACACCCAGCTAATATTTTCTGG - Intronic
1190170632 X:48109184-48109206 CACCCCCAGCTAATTTTTTTTGG + Intergenic
1190174518 X:48138141-48138163 CACACCCAGCTAATATTTTCTGG - Intergenic
1190605937 X:52142519-52142541 TACACTCACTTATTCTTTTGTGG + Intergenic
1191603378 X:63034661-63034683 TACACCCAGCTAATTTTTTTTGG - Intergenic
1192438711 X:71159023-71159045 CACACACACTTAATTTTACAGGG + Intronic
1192488366 X:71551054-71551076 CTCACTAACTTATTTTTTTGTGG - Intronic
1193107894 X:77699288-77699310 CACACCTGGCTAATTTTTTGTGG + Intronic
1193529457 X:82638796-82638818 CACACCTGGCTAATTTTTTGGGG + Intergenic
1194490980 X:94549355-94549377 CACACCAATTTATTTTCTTGAGG + Intergenic
1195196401 X:102501535-102501557 CATACCCAGCTAATTTTTTGTGG + Intergenic
1196789793 X:119453688-119453710 CACACCTAGCTAATTTTTTGGGG + Exonic
1197588763 X:128383261-128383283 CTCACCAACTTATATTTTTGTGG - Intergenic
1197629209 X:128838510-128838532 CACAATGACTTAATTTTTTTTGG + Intergenic
1197859579 X:130956238-130956260 CACGCCCGGCTAATTTTTTGTGG - Intergenic
1198207204 X:134478260-134478282 CACACCCATCTATTTTTTTTTGG + Intronic
1198462457 X:136876862-136876884 CACACCCAGCTAATTTTTGGTGG + Intronic
1199225000 X:145363058-145363080 CACGCCCAACTAATTTTTTGTGG + Intergenic
1201497194 Y:14601256-14601278 CTCGCCCACCTAATTTTTGGTGG + Intronic