ID: 1060460729

View in Genome Browser
Species Human (GRCh38)
Location 9:123852064-123852086
Sequence TTGTTTAAAAGGGGGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060460729_1060460738 28 Left 1060460729 9:123852064-123852086 CCTGCTGGCCCCCTTTTAAACAA 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1060460738 9:123852115-123852137 TGTCCCGCCATTACACTCTGGGG No data
1060460729_1060460737 27 Left 1060460729 9:123852064-123852086 CCTGCTGGCCCCCTTTTAAACAA 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1060460737 9:123852114-123852136 CTGTCCCGCCATTACACTCTGGG No data
1060460729_1060460734 -10 Left 1060460729 9:123852064-123852086 CCTGCTGGCCCCCTTTTAAACAA 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1060460734 9:123852077-123852099 TTTTAAACAATCAGTGTCTTCGG No data
1060460729_1060460736 26 Left 1060460729 9:123852064-123852086 CCTGCTGGCCCCCTTTTAAACAA 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1060460736 9:123852113-123852135 CCTGTCCCGCCATTACACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060460729 Original CRISPR TTGTTTAAAAGGGGGCCAGC AGG (reversed) Intronic
900357398 1:2271428-2271450 TTCTTTAAAAGGGGGCTCCCAGG - Intronic
900698283 1:4026738-4026760 TTTTTTAAAAAGGGGGCGGCTGG - Intergenic
901898454 1:12336247-12336269 TTCTTGAAAAGAGGGCGAGCAGG + Intronic
903229860 1:21915081-21915103 TTGTTACCAAGGGTGCCAGCGGG + Intronic
906000058 1:42417154-42417176 TTATCTAAAAGGAGGCTAGCAGG + Exonic
908205885 1:61848703-61848725 AAGTTTAAAAGGGAGACAGCTGG - Intronic
912358845 1:109077701-109077723 TAGCTCAAAAGGGGGCAAGCAGG - Intergenic
913212910 1:116596297-116596319 TTCTTTAAAACGGGGGTAGCAGG + Intronic
913498022 1:119446192-119446214 TTGTGTGAAAGGGAGGCAGCAGG - Intergenic
913505734 1:119514748-119514770 TTGTATGAAAGGGAGGCAGCAGG - Exonic
913509045 1:119545936-119545958 TTGTGTGAAAGGGAGGCAGCAGG - Intergenic
918366004 1:183808382-183808404 TTGTTGAAATGGGGGCGAGGGGG - Intronic
921167717 1:212518881-212518903 TTGTTTCCAAGGGGACCAGCAGG - Intergenic
923030100 1:230242800-230242822 TTGTGTAAAAGGCAGACAGCAGG + Intronic
1064442334 10:15364903-15364925 TTGATTACAATGGGCCCAGCTGG + Intronic
1066546202 10:36503138-36503160 TAGGTTACAAGGGGGCCAGGAGG - Intergenic
1072957802 10:99902604-99902626 TTTTTTTAAAGGGAGGCAGCCGG - Intronic
1073845042 10:107544999-107545021 TTCTTTCCAAGGGGGCCTGCAGG - Intergenic
1075192315 10:120320896-120320918 AGGTTCAAAAGGGGGCCACCTGG - Intergenic
1075822413 10:125326192-125326214 TTGTTTAAAAGGGAACCACATGG - Intergenic
1079240730 11:18720775-18720797 TTGTGTAAGAGGTGGCCATCAGG + Intronic
1086166634 11:83787217-83787239 TGGTATAAAATGGGGCCAGATGG + Intronic
1090579899 11:128148436-128148458 TTGGCTAAAAGGGGATCAGCAGG - Intergenic
1092020995 12:5202078-5202100 TTCTTTAAGAGGCAGCCAGCAGG - Intergenic
1093551369 12:20415731-20415753 TTAAATAAAAGGAGGCCAGCCGG - Intronic
1095752896 12:45730037-45730059 TTTTTTAAAAGGCGACCTGCGGG - Exonic
1096302575 12:50444114-50444136 TTGGTTAAATTGGGGACAGCTGG + Intronic
1097501792 12:60412375-60412397 TTCTTTAAAAGGAAGCCAGTGGG + Intergenic
1097559978 12:61190767-61190789 TTGTTTCAAAGCTGGCCATCTGG + Intergenic
1100400476 12:94225048-94225070 ATGGTGAAAAGGGGGGCAGCAGG - Intronic
1101913568 12:108879302-108879324 TTTTTTAAAAGAGGGTCGGCTGG - Intronic
1110578276 13:77086251-77086273 TTGTTTAAAAGGCTGTCAGTTGG - Intronic
1120601935 14:86521570-86521592 CTATTTAAAAAGAGGCCAGCTGG + Intergenic
1122439523 14:101720488-101720510 TTTTTAAAGAGGGGGCCAGTTGG + Intergenic
1124610219 15:31203021-31203043 TTGTTGAAAAGGAGGCCCGGCGG - Intergenic
1125976281 15:43954713-43954735 TTGTTTAACAGGGGATCAGAGGG + Intronic
1130798589 15:87236765-87236787 TAGTTTTACAGGTGGCCAGCAGG + Intergenic
1133453197 16:5920643-5920665 TTGTCCAAAAGTGGGGCAGCGGG + Intergenic
1134075855 16:11290784-11290806 GTGTTAAAGATGGGGCCAGCAGG + Intronic
1134562887 16:15226018-15226040 GTGTTGAAAAAGGGGCCAGGTGG - Intergenic
1134923424 16:18137651-18137673 GTGTTGAAAAAGGGGCCAGGTGG - Intergenic
1136066840 16:27765154-27765176 TTGCTCAAAAGGCTGCCAGCTGG + Intronic
1136608386 16:31351890-31351912 TGGTTTAAAAAGGTTCCAGCAGG - Intergenic
1138928189 16:61617652-61617674 TTGTTTATAAGGGGGACAGGTGG - Intergenic
1140458023 16:75115799-75115821 TTGTTTAAAGTGGGCCCACCTGG - Intronic
1141384003 16:83602676-83602698 ATTTTGAAAGGGGGGCCAGCAGG - Intronic
1144818593 17:18054754-18054776 CAGTTAAAAAGGGGGGCAGCAGG - Intronic
1149386574 17:56148546-56148568 TCGTTTACAAGGGGACCTGCAGG + Intronic
1152635635 17:81429529-81429551 TAGTTTGACAGGGTGCCAGCTGG + Intronic
1154424511 18:14261788-14261810 ATGTTTAAATTGGGGCCAGGTGG + Intergenic
1155184692 18:23376871-23376893 CTGTTTAAAAGGAGACTAGCAGG - Intronic
1156826590 18:41436640-41436662 TTGTTTAAAATGAAGACAGCTGG - Intergenic
1157223781 18:45845337-45845359 TTGTTAAAGGGGGTGCCAGCTGG - Intergenic
1158928448 18:62295996-62296018 TTGTTTAATTGGGGGGCAGGGGG + Intronic
1159984780 18:74829008-74829030 TGGTTAAACAGGGGGCCAGTGGG + Intronic
1160515576 18:79477703-79477725 TTGTTTACAAGGTGCCCAGCCGG - Intronic
1163140089 19:15341842-15341864 TTTTTTAAAAGGCTGACAGCCGG - Intergenic
1163818223 19:19480879-19480901 ATGTTTAAAAGAGGGGCAGGAGG + Intronic
1167955825 19:53063083-53063105 TTCTTTGAAAGGGGGGCAGGGGG - Intergenic
1168555737 19:57338409-57338431 TTGCTTAAAAGTGGGCCAAAGGG + Intergenic
924979861 2:209751-209773 CTGTTTAAAATGGGGTCATCAGG - Intergenic
926321513 2:11751554-11751576 TTTTTAAAAATGGGTCCAGCTGG + Intronic
929173816 2:38957862-38957884 TTGCTTAATAGGGTGCAAGCTGG - Intronic
930168648 2:48229308-48229330 CTGTTTAAAAGGAGGCAAACTGG - Intergenic
932546175 2:72712691-72712713 TCCTTTAAAAGAGGGCCAGGAGG - Intronic
934298175 2:91759829-91759851 TTCTTTAAAACGGGGGTAGCAGG - Intergenic
934301633 2:91780061-91780083 TTTTTTAAGAGGGGCTCAGCAGG - Intergenic
935546356 2:104403480-104403502 GTGTTTAAAAGGGGGTCTGAGGG - Intergenic
940940214 2:159551171-159551193 TTATTTAAAAGGTTGCCGGCCGG + Intronic
941687514 2:168462424-168462446 ATTTTTAAAAGGTGGCCAGGGGG - Intronic
943727024 2:191262303-191262325 CTGCATAAAAGTGGGCCAGCTGG - Intronic
944666436 2:201963020-201963042 CTGTTTATAATGGAGCCAGCAGG - Intergenic
947429887 2:230018043-230018065 TTTTTTAAAAAATGGCCAGCAGG + Intergenic
948122894 2:235544043-235544065 TTGTTTAAAGTGGGGGCAGGGGG - Intronic
948248734 2:236507786-236507808 TGGATGAAAATGGGGCCAGCAGG - Intergenic
948748727 2:240115219-240115241 ATGTTTAAAATGTGGTCAGCAGG - Intergenic
1173210561 20:41028788-41028810 TTGTTTAAAAGCGGCCGCGCAGG + Intergenic
1175336942 20:58202730-58202752 TTTTTTAAAAGGCAGCCAGGAGG + Intergenic
1180698288 22:17768277-17768299 TTTTTGAAAAGGCAGCCAGCAGG + Intronic
1181117271 22:20640452-20640474 TTTTTAAAAAGAGGGCCGGCCGG + Intergenic
951557669 3:23937031-23937053 TTGTTGAAAAGGGACCCACCTGG + Intronic
956948939 3:74257600-74257622 CTGTTTAAAAGGTAGCCAGCAGG - Intergenic
958863391 3:99471221-99471243 TTGGTTAAAAAGGGGGCAGGGGG - Intergenic
965129883 3:164684096-164684118 TTAATTAAAAGGGGGTCAGATGG - Intergenic
967852767 3:194094484-194094506 TTGTTTTAAATGTGGCCAGTAGG - Intergenic
968450351 4:673181-673203 TTGTTTAAAAATGGGGAAGCTGG - Intronic
975992986 4:80279941-80279963 TGGTTTCAGAGGGTGCCAGCTGG + Intronic
976338982 4:83924072-83924094 TTGTTTAAAAGTGGGCTTTCAGG - Intergenic
977710265 4:100116362-100116384 TTGCTCAAGAGGGGGCTAGCTGG + Intergenic
977905108 4:102468094-102468116 TTTTTTAAAAAGGGGATAGCAGG - Intergenic
984644912 4:182209267-182209289 TTTTTTTAAAGAGGGACAGCTGG - Intronic
988573750 5:32398633-32398655 TTGTTTACAAGGTGGATAGCTGG - Intronic
990313827 5:54565685-54565707 CTGTTTAAAAGGGGCCTAGAAGG + Intergenic
993038441 5:82784258-82784280 TTGTATGAAAGGGGGCCCACTGG - Intergenic
995034992 5:107523477-107523499 TGGCTCACAAGGGGGCCAGCAGG + Intronic
1001640201 5:173238621-173238643 TCATTTATCAGGGGGCCAGCCGG - Intergenic
1006849947 6:37091200-37091222 ATTTTTAAAAGGGGTCTAGCGGG + Intergenic
1007330407 6:41102319-41102341 TTGTTCAAAGGGGGGGCAGGAGG + Intergenic
1009298067 6:61979818-61979840 TTGTTTATTCTGGGGCCAGCTGG + Intronic
1017282303 6:152637487-152637509 TTGATGAAAAAGGAGCCAGCGGG - Intronic
1022708681 7:32831545-32831567 TTTTTTAAAAAAGGTCCAGCAGG + Intergenic
1024740712 7:52351183-52351205 GCTTTTCAAAGGGGGCCAGCTGG - Intergenic
1025142403 7:56477068-56477090 TTGTTTAAAAGTGTGCAGGCCGG + Intergenic
1026353141 7:69534887-69534909 TTGTTTAAAAAGTGTGCAGCAGG + Intergenic
1028338605 7:89690044-89690066 TTGTTTAGATGGGGGACAGTGGG + Intergenic
1028898360 7:96067275-96067297 TTGTTAGAAAGGCAGCCAGCAGG - Intronic
1031713193 7:125075142-125075164 GTGTTGAAAAGGGGGCCTGGTGG + Intergenic
1035560881 8:602634-602656 TTATTTAAAATGGGTCCTGCGGG - Intergenic
1037764154 8:21761647-21761669 TTGTTTAAAAAGGTGTCACCTGG + Intronic
1038822920 8:30969440-30969462 TTGGTTGAAAGGGAGCCAGTGGG + Intergenic
1043773464 8:84234655-84234677 ATGTTTAAAAGGTGGGCAGATGG - Intronic
1055571504 9:77621829-77621851 TTGTTTTGAAGGCTGCCAGCTGG + Intronic
1056057496 9:82842074-82842096 GTTTGTAAAAGGAGGCCAGCCGG + Intergenic
1056971698 9:91210034-91210056 TTGTCAAAAAGGGGGCAAGATGG - Intergenic
1060460729 9:123852064-123852086 TTGTTTAAAAGGGGGCCAGCAGG - Intronic
1194816855 X:98452731-98452753 TTGTTTCAAATGTGGCCAGTGGG + Intergenic
1196797873 X:119516557-119516579 CTGATGAAAAGGGGGCTAGCTGG + Intergenic
1197693765 X:129529336-129529358 TTGTTTAAAAAGAGGCCGGAGGG + Intergenic
1199467862 X:148159985-148160007 TTTTTTTAAAGGTGGCCAGGAGG + Intergenic