ID: 1060460730

View in Genome Browser
Species Human (GRCh38)
Location 9:123852072-123852094
Sequence GACACTGATTGTTTAAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 226}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060460730_1060460736 18 Left 1060460730 9:123852072-123852094 CCCCCTTTTAAACAATCAGTGTC 0: 1
1: 0
2: 2
3: 28
4: 226
Right 1060460736 9:123852113-123852135 CCTGTCCCGCCATTACACTCTGG No data
1060460730_1060460742 28 Left 1060460730 9:123852072-123852094 CCCCCTTTTAAACAATCAGTGTC 0: 1
1: 0
2: 2
3: 28
4: 226
Right 1060460742 9:123852123-123852145 CATTACACTCTGGGGAAGAGTGG No data
1060460730_1060460738 20 Left 1060460730 9:123852072-123852094 CCCCCTTTTAAACAATCAGTGTC 0: 1
1: 0
2: 2
3: 28
4: 226
Right 1060460738 9:123852115-123852137 TGTCCCGCCATTACACTCTGGGG No data
1060460730_1060460737 19 Left 1060460730 9:123852072-123852094 CCCCCTTTTAAACAATCAGTGTC 0: 1
1: 0
2: 2
3: 28
4: 226
Right 1060460737 9:123852114-123852136 CTGTCCCGCCATTACACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060460730 Original CRISPR GACACTGATTGTTTAAAAGG GGG (reversed) Intronic
902306409 1:15542923-15542945 GACACTCATTGTGTAAGAGATGG - Intronic
908374200 1:63516825-63516847 GACACTGAGACTTCAAAAGGAGG + Intronic
908836904 1:68237475-68237497 CACAGTTATTGTGTAAAAGGAGG - Intergenic
909094610 1:71271439-71271461 GACAGTGATAGTTTAAAGGCTGG + Intergenic
909667457 1:78151170-78151192 GACACTGAGTTTTCAAAAGCTGG + Intergenic
910202100 1:84710301-84710323 GACATTGATTGTTTCAGTGGCGG + Intergenic
910737109 1:90471799-90471821 GATACTTATTGATTAAAAAGAGG + Intergenic
913203662 1:116516512-116516534 GACACTGAATATTTGCAAGGAGG - Intronic
914771758 1:150692917-150692939 GTCACTGACTGTATAAAAAGAGG - Intronic
915204791 1:154262036-154262058 GGCACTGATAGTACAAAAGGGGG + Intronic
915253130 1:154604726-154604748 GAGACTGATTATATAAAGGGTGG - Intronic
915696338 1:157746474-157746496 CACACTGATTGCTTAAGAGAAGG + Exonic
915766416 1:158366877-158366899 GACACAGTTTTTTTCAAAGGGGG + Intergenic
917303501 1:173603639-173603661 GCCACTGACTGCTTAAAAGGTGG + Intergenic
918207361 1:182321480-182321502 TCCACTGATTTTTTAAAAAGGGG - Intergenic
918243708 1:182641414-182641436 CACACTGATTGTATAAAGTGAGG + Intergenic
918502588 1:185214840-185214862 GACACTGCTTCCATAAAAGGAGG - Intronic
919508407 1:198429445-198429467 GAGACTGATGGTTTAGAAGGGGG - Intergenic
919599959 1:199610421-199610443 GAAACTGAGTGAATAAAAGGAGG - Intergenic
923259551 1:232255087-232255109 GACACTGAAAGTTTAAAAAATGG - Intergenic
924027901 1:239856392-239856414 AAATCTGATTGTTTAAAAGTGGG + Intronic
924466944 1:244306659-244306681 ATAACTGATTGTTTAAAAAGAGG + Intergenic
1063505072 10:6590459-6590481 GACAAAGAATATTTAAAAGGAGG + Intergenic
1064401855 10:15028113-15028135 GCCACTGACTGCTTAAAAGGTGG + Intergenic
1064851766 10:19716186-19716208 GATACGTATTTTTTAAAAGGAGG + Intronic
1065260705 10:23920653-23920675 GTCACTGACTGTTCAAAAGGAGG - Intronic
1067004124 10:42645431-42645453 GCCACTGACTGCTTAAAAGGTGG + Intergenic
1067005249 10:42654824-42654846 GCCACTGATTGCTTAAAATGTGG + Intergenic
1067326972 10:45278666-45278688 TTAACTGGTTGTTTAAAAGGAGG - Intergenic
1067909786 10:50334547-50334569 AACACTGTTTTTTTAACAGGGGG + Intronic
1069176657 10:65297869-65297891 GAAACCTATTTTTTAAAAGGGGG + Intergenic
1071241012 10:83704874-83704896 TACTCTCATTTTTTAAAAGGAGG - Intergenic
1072402922 10:95123861-95123883 ATAACTGATTGTTTAAAAAGCGG - Intergenic
1073555734 10:104449104-104449126 CACATTCATTGTTTAGAAGGAGG + Intronic
1073837471 10:107461301-107461323 TACATTGAATGTTAAAAAGGAGG + Intergenic
1074071712 10:110077359-110077381 GACACTGACTGTTCAAATGAAGG + Intronic
1074390579 10:113054221-113054243 GACACACATGGTATAAAAGGAGG - Intronic
1076856623 10:133118598-133118620 GAGACTGAATGTTTTATAGGAGG - Intronic
1078204484 11:9216303-9216325 TTCACTGAAAGTTTAAAAGGTGG - Intronic
1078688062 11:13551302-13551324 GACACTGATGCTTTCCAAGGTGG - Intergenic
1079528432 11:21418781-21418803 GGCACAGATTTTTAAAAAGGAGG - Intronic
1081053607 11:38379086-38379108 GACATAGATTGTTTAGAAGTAGG + Intergenic
1084233565 11:67770948-67770970 AACCCTGGTTGTTTAAAACGGGG + Intergenic
1084310646 11:68314178-68314200 GAAACTGTTTGTTTTAAAGGGGG + Intronic
1085974674 11:81637860-81637882 ATGACTGCTTGTTTAAAAGGAGG + Intergenic
1086194509 11:84121456-84121478 GACAGTGACTTTTAAAAAGGAGG - Intronic
1088433951 11:109790151-109790173 GACACAGTTTTTTCAAAAGGAGG - Intergenic
1088691830 11:112334914-112334936 GACACAGAATGTTGAAAAGGAGG + Intergenic
1089264428 11:117248640-117248662 GATACTGAATGATTAGAAGGTGG + Intronic
1090975189 11:131673912-131673934 GACTCTGATGGGTTGAAAGGCGG + Intronic
1091322959 11:134664722-134664744 GACAGTGGTGGTTTGAAAGGGGG + Intergenic
1094136201 12:27129251-27129273 GATACTGAATGTTTAAAAACAGG + Intergenic
1094561929 12:31563052-31563074 CAAACTTTTTGTTTAAAAGGTGG + Intronic
1094597110 12:31875452-31875474 GGCTGTAATTGTTTAAAAGGTGG + Intergenic
1096057804 12:48669449-48669471 GTCAATGATTGATTAAAAAGTGG - Intronic
1102616796 12:114161722-114161744 TACTCTGATTTGTTAAAAGGTGG + Intergenic
1103112776 12:118295759-118295781 GGCACAGATTTTTTAAAAGATGG - Intronic
1105488840 13:20866655-20866677 GACACTGACTATTTAAAAGGTGG - Intronic
1106287533 13:28330661-28330683 GTCTCTGATTTATTAAAAGGGGG - Intronic
1106894290 13:34281419-34281441 AACACTAAGTGTTAAAAAGGGGG - Intergenic
1107490280 13:40874891-40874913 GCCACTGACTGCTTAAAAGGTGG + Intergenic
1107674403 13:42779538-42779560 GACATTGGCTGTTTAGAAGGTGG - Intergenic
1110053456 13:70934929-70934951 TACAATGATTGGTGAAAAGGAGG + Intergenic
1112951556 13:105003785-105003807 GCCACTGATCGTTAAGAAGGAGG + Intergenic
1113738151 13:112692275-112692297 AACACTCAGTGTTAAAAAGGAGG + Intronic
1115714378 14:36086470-36086492 GAGACTGAATGATTAGAAGGAGG + Intergenic
1116329688 14:43579730-43579752 ATGACTGGTTGTTTAAAAGGAGG + Intergenic
1118118430 14:62807742-62807764 ATGACTGGTTGTTTAAAAGGAGG + Intronic
1118173425 14:63412262-63412284 GACCCTGTTTGTTTAAAAAAGGG + Intronic
1120632553 14:86908557-86908579 TAAACTGAGTGTTTAAAAGGCGG + Intronic
1120865277 14:89291104-89291126 GACCCTGTTAGTGTAAAAGGTGG + Intronic
1123223426 14:106877861-106877883 GCCACTGACTGTGTAAAAGGTGG + Intergenic
1124889810 15:33722444-33722466 GACACTGATGGAGAAAAAGGTGG - Intronic
1125140824 15:36404978-36405000 TACATTTGTTGTTTAAAAGGAGG + Intergenic
1127324955 15:57885949-57885971 TACAATGATTGTTTTAAAGATGG + Intergenic
1128599578 15:68984506-68984528 GCCACTGACTGCTTAAAAGGTGG + Intronic
1130153593 15:81331179-81331201 GCCACCGACTGCTTAAAAGGTGG - Intergenic
1131420091 15:92298114-92298136 GCCACTGACTGTTTTAAAAGTGG + Intergenic
1131534288 15:93221687-93221709 GCCACCGACTGCTTAAAAGGTGG - Intergenic
1131549513 15:93344959-93344981 ACCACTGACTGCTTAAAAGGTGG + Intergenic
1133390858 16:5408827-5408849 AACTCTGACTGTTTAAAAGTGGG - Intergenic
1140246785 16:73257713-73257735 GAAACTGATTGGCTGAAAGGAGG + Intergenic
1142249002 16:88982647-88982669 GCCACTGAAGGTTTAAGAGGAGG - Intergenic
1143032420 17:3975151-3975173 GACATTGATTGGTTAAATGAAGG + Intergenic
1143441389 17:6977056-6977078 GACAGTGATTGGTTCAAAGATGG - Intronic
1143862668 17:9902146-9902168 GATACTCATTGAATAAAAGGAGG - Intronic
1145114506 17:20196617-20196639 TAAAATGGTTGTTTAAAAGGAGG - Intronic
1145263501 17:21368389-21368411 TTCACTGAATGCTTAAAAGGTGG - Intergenic
1145853775 17:28132323-28132345 AACATTGATTGTTTAAAATAGGG + Intronic
1146123353 17:30213626-30213648 AAAACTGATTTTTTTAAAGGTGG - Intronic
1148139668 17:45319103-45319125 GACACTGGGTGTTTTAAAGAAGG - Intergenic
1148977291 17:51540579-51540601 GCCACTGAATGTTTAAAAAATGG - Intergenic
1149222665 17:54433496-54433518 GCCACTGAGTATATAAAAGGGGG - Intergenic
1149723162 17:58865755-58865777 GAGACTGATAGTCTAAAAAGGGG - Intronic
1151433908 17:74082407-74082429 CACTCTGAGTGTCTAAAAGGGGG + Intergenic
1155178447 18:23322130-23322152 GACTCTAATTTTTTAAAAGCAGG + Intronic
1155565974 18:27134652-27134674 GACAATGAGTTTTTAAAAGGTGG + Intronic
1156267650 18:35503111-35503133 AATACTGATTGTTTACAATGAGG - Intergenic
1156373361 18:36490786-36490808 GTCAGTGATTGTTTGAAAGAAGG + Intronic
1156692244 18:39722259-39722281 GACACTGATAATTCAGAAGGTGG + Intergenic
1157121217 18:44913034-44913056 GAAACTGAGTGTTTTAAAAGAGG + Intronic
1157478567 18:48038376-48038398 AACACTGATTATTTCCAAGGTGG - Intronic
1158077004 18:53542653-53542675 AACAAGGATTGTTTAAAAGAAGG - Intergenic
1158190078 18:54817718-54817740 TACACTGACTGTGTAGAAGGTGG - Intronic
1162710309 19:12588297-12588319 AACACTAATTTTTTAAAAGCTGG + Intronic
1164470482 19:28526056-28526078 ATAACTGGTTGTTTAAAAGGAGG + Intergenic
1165477677 19:36040657-36040679 GATGCTGGGTGTTTAAAAGGTGG - Intronic
1166974700 19:46599148-46599170 GCCACTGAGTGCTAAAAAGGAGG - Intronic
1167610924 19:50507428-50507450 GGCACTGATGGGTTGAAAGGGGG - Intronic
1168439977 19:56356279-56356301 ACCACTGATTGTTTAAAAGGTGG - Intronic
926521820 2:13924860-13924882 ATGACTGATTGTTTAAAAAGAGG + Intergenic
927168489 2:20349460-20349482 GTAAATCATTGTTTAAAAGGAGG + Intronic
927803299 2:26121301-26121323 GTCAATGACAGTTTAAAAGGGGG - Intronic
930517532 2:52427241-52427263 GTTACTTATTATTTAAAAGGTGG - Intergenic
931934276 2:67178622-67178644 GACTCTGATTCTTTAAAGGGTGG - Intergenic
933614230 2:84467702-84467724 ATGACTGGTTGTTTAAAAGGAGG - Intergenic
935593350 2:104861357-104861379 GAAATTAATTATTTAAAAGGTGG + Intergenic
936586535 2:113763257-113763279 GCCTCTGGTTGTTTAAAAGTGGG - Intergenic
936597889 2:113866668-113866690 GACTCTAGTTGTTAAAAAGGAGG - Intergenic
939725012 2:145708359-145708381 TACACTAATTTTTTAAAAGGAGG - Intergenic
940591120 2:155728986-155729008 GACTCTGATGGTTCAAAAGAAGG - Intergenic
941463732 2:165800825-165800847 GAAAATGATTTTTTTAAAGGTGG + Intergenic
941479990 2:165995536-165995558 GATACTAAGTGTTTTAAAGGAGG - Intronic
944146280 2:196510633-196510655 GACACTGATTTTTTTAAGGTAGG + Intronic
944385504 2:199159461-199159483 CACACACATTGTTTAATAGGTGG - Intergenic
945508955 2:210676706-210676728 GATACTTATTTTTTAAAAAGAGG - Intronic
1169681844 20:8224052-8224074 CAGACTGCTTGTTTAAAATGTGG - Intronic
1169753675 20:9021600-9021622 GACACAGATTGCTTAAAATGAGG + Intergenic
1173275932 20:41582206-41582228 GAGACTGATTTCTTAAAAGCAGG - Intronic
1176874550 21:14115384-14115406 GCCACTGACAGCTTAAAAGGTGG + Intronic
1176875683 21:14124661-14124683 GACACTGACAGCTTAAAAGGTGG + Intronic
1177642868 21:23866064-23866086 CACATTGATTCTTTAAAAGATGG + Intergenic
1181039528 22:20185200-20185222 GACCCTGTCTTTTTAAAAGGTGG - Intergenic
1181337539 22:22150601-22150623 CACATTAATTGTTTTAAAGGGGG + Intergenic
1181810960 22:25403847-25403869 GAAGCTGTTTGTTTTAAAGGGGG - Intronic
1184800013 22:46753347-46753369 GACACTGGTTCTTCCAAAGGAGG - Intergenic
1185360305 22:50402846-50402868 GACACTGATTCTCTAGATGGAGG - Intronic
950954131 3:17032963-17032985 GACATTGATTGTGTTAGAGGAGG + Intronic
952784992 3:37144231-37144253 CACACTGATTCCTTAATAGGAGG + Intronic
955660662 3:61295404-61295426 GACAATGATTGGTTAAGAGGTGG - Intergenic
956232539 3:67033178-67033200 GCCACTTATGGTTTAATAGGAGG + Intergenic
960235987 3:115282700-115282722 GATACTGATTGTGTAGAGGGAGG + Intergenic
960386850 3:117030761-117030783 ATGACTGGTTGTTTAAAAGGAGG + Intronic
960769601 3:121178943-121178965 GCCACAGATTCTTTTAAAGGGGG - Intronic
961883147 3:130077304-130077326 AACACTGATTGTCTAAAACGGGG + Intergenic
963133824 3:141882190-141882212 AACACTGATTGTGAAATAGGAGG + Intronic
964637346 3:158871953-158871975 GAAACTGACTTTTTAAAAGTTGG - Intergenic
964989604 3:162791783-162791805 GACACTGTATGTTTGAGAGGTGG - Intergenic
965153691 3:165016801-165016823 GAAATTTATTATTTAAAAGGAGG - Intronic
965591370 3:170363027-170363049 AACACTAAGTGTTTAAAATGTGG + Intronic
965828510 3:172754673-172754695 GAAATTGATTGTTTTAAAGCAGG - Intronic
966952886 3:184839772-184839794 GACACTTAATATTTAAAAGCAGG - Intronic
967525692 3:190489756-190489778 GACTCTGACTGTGTGAAAGGAGG - Intergenic
971840602 4:31847366-31847388 ATCACTGATTTTTTAAAAGCTGG - Intergenic
971850287 4:31977001-31977023 GACACCGTTTTTTAAAAAGGTGG + Intergenic
972871858 4:43310310-43310332 GTCACTGAATATTTAAAGGGAGG - Intergenic
975043279 4:69770669-69770691 GTAACTGTTTGTTTAAAAGAAGG + Intronic
976359696 4:84162829-84162851 AACACGGATTGTTAAATAGGAGG + Intergenic
976772630 4:88670474-88670496 TACTCTGATTTTTTTAAAGGGGG - Intronic
977084982 4:92583382-92583404 GACTCTAATTGTTGGAAAGGAGG - Intronic
977291216 4:95166790-95166812 CACACACATTTTTTAAAAGGAGG - Exonic
977903728 4:102452155-102452177 GAGACTGATTGATGATAAGGCGG - Intergenic
979173654 4:117634710-117634732 GGAACTAATTTTTTAAAAGGCGG + Intergenic
982208362 4:153014803-153014825 GAGACTGATTGATAAACAGGAGG - Intergenic
984292618 4:177814367-177814389 GACACTGATGTTTTAAAAAGAGG - Intronic
984461993 4:180048837-180048859 GTCAATGATTTTTTAAAAGTTGG + Intergenic
984656344 4:182322759-182322781 GACACTGATTCTTTGAGAGAGGG + Intronic
985232134 4:187830552-187830574 TAAACTGATTTTTTAAAATGTGG - Intergenic
989300920 5:39892788-39892810 CACTCTGAATGTTTAAAATGAGG - Intergenic
990628733 5:57643354-57643376 GAAAGTAATTGATTAAAAGGAGG + Intergenic
993564888 5:89461636-89461658 GACACTGAGTATTTCAAAAGCGG + Intergenic
996199686 5:120656133-120656155 GACAGTCATTGGTGAAAAGGTGG - Intronic
997647264 5:135489685-135489707 AACAGCAATTGTTTAAAAGGGGG + Intergenic
998005357 5:138653329-138653351 GACAGAGATTATTTCAAAGGAGG + Intronic
998781878 5:145666280-145666302 CACAGTGATTGTTTCAAGGGTGG - Intronic
999552861 5:152708335-152708357 GACACATATTGTTTAAGAGTTGG - Intergenic
999664915 5:153902739-153902761 GACACATATTATTTATAAGGAGG - Intergenic
1001160379 5:169307386-169307408 TACACTGATTTTTTAAGGGGCGG + Intergenic
1001739698 5:174042259-174042281 GACACTGACTTTTAAAAAGGAGG - Intergenic
1002885411 6:1289542-1289564 GACCCTGAGTGTTTAGAAGCTGG + Intergenic
1003199466 6:3945840-3945862 AACACTGGGTGTTTAAAAAGTGG - Intergenic
1003745611 6:8998236-8998258 CACAGAGATTTTTTAAAAGGTGG + Intergenic
1004640200 6:17507684-17507706 GACCCTGTTAGTGTAAAAGGTGG - Exonic
1007148088 6:39657533-39657555 GACACTGCTTGTTAAAATGTGGG - Intronic
1007412508 6:41673258-41673280 GACACTAATTGTTCATTAGGAGG + Intergenic
1008657013 6:53625772-53625794 GACACTGAATATTTGAAAGCAGG + Intergenic
1008719854 6:54335809-54335831 GAAAATGATTTTTTAAAAGTTGG - Intronic
1010783935 6:79978084-79978106 GACACTGCCTCTATAAAAGGGGG - Intergenic
1010908232 6:81519929-81519951 GAGACTGATTCTTTAACAGGGGG - Intronic
1011166484 6:84453365-84453387 GATACTAATTGATTAAAAGTAGG - Intergenic
1011966329 6:93162459-93162481 GAGAATGATGGTTTAAAGGGAGG - Intergenic
1012192159 6:96293578-96293600 GGGACTGATGGATTAAAAGGTGG - Intergenic
1012367754 6:98463287-98463309 GATGCTGATTGTTTAAAAAGAGG + Intergenic
1013211547 6:107991428-107991450 ACCACTGACTGCTTAAAAGGTGG + Intergenic
1016385762 6:143529681-143529703 GACACTGATTTTAAAAAAAGAGG - Intergenic
1017051457 6:150397838-150397860 GCCACTGCTTGGTTAAAAGAAGG + Intronic
1018886988 6:167947657-167947679 GGCTCTGATTATTTAAAAGATGG + Intronic
1020501198 7:8923243-8923265 TACACAGAGTGTTTAAAAGATGG - Intergenic
1021242703 7:18224231-18224253 AACACTGAATGTCTAAAAAGAGG - Intronic
1024210200 7:47196815-47196837 TTCACTGATTCTTTGAAAGGGGG - Intergenic
1024779086 7:52825273-52825295 GACATTTATCGTGTAAAAGGTGG + Intergenic
1025768966 7:64485607-64485629 ATGACTGGTTGTTTAAAAGGAGG + Intergenic
1031087101 7:117313325-117313347 CACACTGACTTTTTAAAATGTGG - Intronic
1031426715 7:121614410-121614432 GAAACTGAATGTTTCTAAGGTGG + Intergenic
1031666341 7:124488003-124488025 GAGACAGAATTTTTAAAAGGAGG + Intergenic
1031821660 7:126509641-126509663 TACACAGATTTTTTAAAATGAGG + Intronic
1031876314 7:127145914-127145936 GATACTGCTTTTTTAAAAGTAGG - Intronic
1032158560 7:129491632-129491654 AACACAGATTGTTTATATGGTGG + Intergenic
1033136945 7:138793323-138793345 CACAATGATTTTTTAAAAGAAGG + Intronic
1033505485 7:141995632-141995654 GGCACTGAATGTTTAATCGGTGG - Intronic
1034333622 7:150305773-150305795 GCCACTGACTGTTTTCAAGGAGG - Intronic
1034664421 7:152804117-152804139 GCCACTGACTGTTTTCAAGGAGG + Intronic
1034731846 7:153393760-153393782 ATTACTGATTGTTTAAAAGAGGG + Intergenic
1034885446 7:154795005-154795027 CACAGTGATTGTTTCTAAGGTGG + Intronic
1036963568 8:13272085-13272107 GACATTGACTTTTTAAAAGAAGG - Intronic
1037961187 8:23099453-23099475 AACATTGATTGTCTAAAATGGGG - Intronic
1037970490 8:23168404-23168426 AACATTGATTGTCTAAAATGGGG + Intergenic
1039379096 8:37068088-37068110 GATACTGTTTCTTTACAAGGAGG + Intergenic
1039509799 8:38081939-38081961 GCCACTGACTGCTTAAAAGGTGG - Intergenic
1039510995 8:38091691-38091713 GCCACTGACTGCTTAAAAGGTGG - Intergenic
1043070374 8:75629556-75629578 ATGACTGGTTGTTTAAAAGGAGG - Intergenic
1043187610 8:77174202-77174224 CACACTGACTTTTTAAAATGTGG - Intergenic
1045629546 8:104102262-104102284 GAGACTGAGTGTATAGAAGGAGG - Intronic
1046948057 8:119993056-119993078 GAAGCTGATTACTTAAAAGGGGG - Intronic
1048586771 8:135781351-135781373 GCCACTGATTGTGTGAACGGTGG + Intergenic
1049160439 8:141094426-141094448 GACACTGGTTGCTTAACAGCAGG + Intergenic
1049500575 8:142961529-142961551 ATAACTGGTTGTTTAAAAGGAGG + Intergenic
1050271589 9:3951662-3951684 GACACTGATTTTAATAAAGGGGG + Intronic
1050712650 9:8483299-8483321 GACACTGATGTATTAAAAGTAGG - Intronic
1051039779 9:12793555-12793577 GAGACTAATTTTGTAAAAGGTGG + Intronic
1052663594 9:31467419-31467441 ATCACTGGTTGTTTAAAAGAAGG - Intergenic
1053524178 9:38812054-38812076 TCCACTGCTTTTTTAAAAGGGGG - Intergenic
1054196411 9:62036464-62036486 TCCACTGCTTTTTTAAAAGGGGG - Intergenic
1054641995 9:67552223-67552245 TCCACTGCTTTTTTAAAAGGGGG + Intergenic
1059294625 9:113259406-113259428 AACACTGCTTGTTTGAAAGCAGG - Intronic
1060460730 9:123852072-123852094 GACACTGATTGTTTAAAAGGGGG - Intronic
1060681623 9:125570208-125570230 ATAACTGGTTGTTTAAAAGGAGG + Intronic
1060869011 9:127024108-127024130 GACACTGATAGGTTATAAGTAGG + Intronic
1187313938 X:18174356-18174378 GCAACTGACTCTTTAAAAGGTGG + Intronic
1187935575 X:24332577-24332599 GACAATGATTGGTTCAGAGGTGG - Intergenic
1188532358 X:31156214-31156236 GGCTCTGAATGTTTTAAAGGGGG - Intronic
1190963271 X:55273249-55273271 ATGACTGGTTGTTTAAAAGGAGG + Intronic
1190963415 X:55274628-55274650 ATGACTGGTTGTTTAAAAGGAGG + Intronic
1192038165 X:67588292-67588314 CACACTGTTTGATTAAAAGGAGG + Intronic
1194114170 X:89874764-89874786 AACACTGAATGTATAAAAAGTGG - Intergenic
1195566206 X:106342050-106342072 TACACTGATTGTTTAATAAAGGG - Intergenic
1196188189 X:112766761-112766783 CACACTATTTTTTTAAAAGGTGG + Intergenic
1196318211 X:114254957-114254979 GACATTGAATGTTTAAAAGCAGG + Intergenic
1196476755 X:116095904-116095926 GACACTAAGTGTTGGAAAGGAGG - Intergenic
1196595410 X:117540230-117540252 TACAATAATTTTTTAAAAGGAGG + Intergenic
1196693802 X:118589646-118589668 GCCACTGATATTTTAAAATGTGG + Intronic
1197032246 X:121830340-121830362 CAGACTGATTTTTTTAAAGGTGG + Intergenic
1197103917 X:122690321-122690343 GACATTGATGATTTAGAAGGAGG + Intergenic
1198366363 X:135944040-135944062 TACACAAATTTTTTAAAAGGAGG + Intergenic
1198723174 X:139647056-139647078 GACACTTTAAGTTTAAAAGGTGG + Intronic
1198831248 X:140753161-140753183 GAGACTGGTAGTTGAAAAGGTGG - Intergenic
1201451529 Y:14120800-14120822 AAAACTGATTGTTTAAAAGTGGG + Intergenic