ID: 1060460731

View in Genome Browser
Species Human (GRCh38)
Location 9:123852073-123852095
Sequence AGACACTGATTGTTTAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 284}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060460731_1060460742 27 Left 1060460731 9:123852073-123852095 CCCCTTTTAAACAATCAGTGTCT 0: 1
1: 0
2: 1
3: 24
4: 284
Right 1060460742 9:123852123-123852145 CATTACACTCTGGGGAAGAGTGG No data
1060460731_1060460736 17 Left 1060460731 9:123852073-123852095 CCCCTTTTAAACAATCAGTGTCT 0: 1
1: 0
2: 1
3: 24
4: 284
Right 1060460736 9:123852113-123852135 CCTGTCCCGCCATTACACTCTGG No data
1060460731_1060460743 30 Left 1060460731 9:123852073-123852095 CCCCTTTTAAACAATCAGTGTCT 0: 1
1: 0
2: 1
3: 24
4: 284
Right 1060460743 9:123852126-123852148 TACACTCTGGGGAAGAGTGGTGG No data
1060460731_1060460738 19 Left 1060460731 9:123852073-123852095 CCCCTTTTAAACAATCAGTGTCT 0: 1
1: 0
2: 1
3: 24
4: 284
Right 1060460738 9:123852115-123852137 TGTCCCGCCATTACACTCTGGGG No data
1060460731_1060460737 18 Left 1060460731 9:123852073-123852095 CCCCTTTTAAACAATCAGTGTCT 0: 1
1: 0
2: 1
3: 24
4: 284
Right 1060460737 9:123852114-123852136 CTGTCCCGCCATTACACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060460731 Original CRISPR AGACACTGATTGTTTAAAAG GGG (reversed) Intronic
900897302 1:5492779-5492801 AGACAGTGATTGTTTAGCTGTGG - Intergenic
902780862 1:18703978-18704000 AGACTCTCTTTGTTTAATAGGGG - Intronic
903103000 1:21049456-21049478 AGCTCCTGATTGTTTAAATGAGG - Intronic
905743384 1:40391828-40391850 AGATACTGGTTGTTGCAAAGAGG + Intronic
908141013 1:61184744-61184766 TGACAATGCTTTTTTAAAAGGGG - Intronic
910215591 1:84840765-84840787 ACACAATTATTGTTTTAAAGAGG - Intronic
911271812 1:95810748-95810770 AGAAAGAGATTTTTTAAAAGAGG + Intergenic
914217219 1:145643009-145643031 AGAGACTGATATTTTAGAAGGGG + Intronic
914469789 1:147965689-147965711 AGAGACTGATATTTTAGAAGGGG + Intronic
917707854 1:177652883-177652905 AGACACTGTGTGTGAAAAAGAGG + Intergenic
917754229 1:178083307-178083329 AGGATCTGATGGTTTAAAAGTGG + Intergenic
919482915 1:198111449-198111471 AGCCACTGATGGGTTCAAAGAGG + Intergenic
919508408 1:198429446-198429468 AGAGACTGATGGTTTAGAAGGGG - Intergenic
920355480 1:205368992-205369014 AGACCCTGATTTTTAAAAGGGGG - Intergenic
920505913 1:206515271-206515293 AGAAACTGATTGTTGAAAATTGG - Intronic
921072323 1:211671873-211671895 AGGCACTGATTGTCAAAAAGTGG - Intronic
924027900 1:239856391-239856413 GAAATCTGATTGTTTAAAAGTGG + Intronic
924309920 1:242729900-242729922 ATACACTCATTCTTTAAATGTGG + Intergenic
1062872031 10:913213-913235 AGAGACTGATAGTCTAAAGGAGG + Intronic
1064867693 10:19900314-19900336 ACTAACTGATTGTTTAAAAGAGG - Intronic
1065756418 10:28935118-28935140 AGCCACTGAGTATTTTAAAGGGG + Intergenic
1066443432 10:35460216-35460238 AGAGAGAGATTTTTTAAAAGAGG - Intronic
1066690288 10:38019897-38019919 AGACAATTATATTTTAAAAGTGG + Intronic
1067002476 10:42629957-42629979 AGACAATTATATTTTAAAAGTGG - Intronic
1068692628 10:59932531-59932553 AGATACTGAGTTTTTAAAATTGG - Intergenic
1068783867 10:60948705-60948727 AAACACTTATTCTTTAAAATGGG - Intronic
1069101401 10:64325471-64325493 AGACACTGTATATGTAAAAGTGG + Intergenic
1069127636 10:64656818-64656840 AGAAATTGATTTTTTAAAATCGG - Intergenic
1069176656 10:65297868-65297890 AGAAACCTATTTTTTAAAAGGGG + Intergenic
1071389181 10:85153307-85153329 AGATACTTTTGGTTTAAAAGAGG + Intergenic
1075043692 10:119128810-119128832 AAAATCTGGTTGTTTAAAAGTGG - Intronic
1075584697 10:123649087-123649109 AGACACTGATTCTCTAACAAAGG + Intergenic
1078421217 11:11214704-11214726 AAACACTGACTGTTTGCAAGTGG + Intergenic
1078492148 11:11779337-11779359 AGAGAGAGATTGTTTAAAAATGG + Intergenic
1079844087 11:25442407-25442429 AGAAACTGGCTGTTTAAATGAGG + Intergenic
1080236646 11:30076722-30076744 AGTCACTAATTATTTAAAAAGGG - Intergenic
1080834759 11:35929843-35929865 AGACACTGATTTTATCAAACCGG - Intergenic
1083061380 11:59876315-59876337 AGATATTGATTATTTCAAAGTGG - Intergenic
1084233564 11:67770947-67770969 AAACCCTGGTTGTTTAAAACGGG + Intergenic
1084310645 11:68314177-68314199 GGAAACTGTTTGTTTTAAAGGGG + Intronic
1084718204 11:70887299-70887321 AGAAAGTGATGGTTTAAATGTGG - Intronic
1087663216 11:101011769-101011791 AGAACCTGAATATTTAAAAGAGG + Intergenic
1088831003 11:113536818-113536840 ACACACCGATTGTTAAAATGAGG + Intergenic
1088913808 11:114211896-114211918 AGACACTGGCTTCTTAAAAGAGG - Intronic
1090509354 11:127357012-127357034 AGACACTGAAGGGTTAAAAATGG - Intergenic
1090760925 11:129836205-129836227 AGACATTTCTAGTTTAAAAGTGG - Intronic
1091322958 11:134664721-134664743 AGACAGTGGTGGTTTGAAAGGGG + Intergenic
1091604700 12:1940304-1940326 AGACACTGATTCTTCTGAAGTGG + Intergenic
1091861074 12:3784245-3784267 TGATACTGATAGGTTAAAAGTGG - Intergenic
1092287740 12:7139041-7139063 AGATACTGGTTGATTAAATGAGG - Intronic
1092891428 12:12972779-12972801 CGACAAATATTGTTTAAAAGTGG - Intergenic
1097254357 12:57661382-57661404 AATGACTGGTTGTTTAAAAGAGG + Intergenic
1097392771 12:59035760-59035782 AGTCACTGAATGTTTATGAGAGG + Intergenic
1097511673 12:60550053-60550075 AAAAACTGATGGTTTGAAAGAGG - Intergenic
1098896932 12:76073656-76073678 AAACACTGATTATTTATAGGTGG + Intronic
1099535395 12:83837392-83837414 AGACACTGGTAATTTAAAAAAGG + Intergenic
1101250185 12:102926180-102926202 AGACACTGAGTTTTAAAAAGAGG + Intronic
1104098010 12:125577857-125577879 AAACATTGGTTGTTTAAAAGAGG + Intronic
1104540291 12:129657774-129657796 AGACACTGGATGTTTAACACAGG + Intronic
1104706227 12:130949552-130949574 AGACACTGATTGGTTCTGAGTGG + Intergenic
1106287534 13:28330662-28330684 AGTCTCTGATTTATTAAAAGGGG - Intronic
1106995571 13:35476432-35476454 ACACAAGGATTCTTTAAAAGAGG - Exonic
1107581159 13:41788299-41788321 AAACCCAAATTGTTTAAAAGTGG - Intronic
1108141848 13:47431791-47431813 TGAGACTGGTTGATTAAAAGAGG + Intergenic
1108770836 13:53698959-53698981 AGGATCTGATGGTTTAAAAGTGG + Intergenic
1111131991 13:83988981-83989003 ACACACTGATTATTTCTAAGTGG + Intergenic
1111209244 13:85055034-85055056 AGGCAATGATTTATTAAAAGAGG + Intergenic
1112132350 13:96537915-96537937 GGACAGTGATGGTTTCAAAGGGG + Intronic
1112806860 13:103172626-103172648 AGACACTGCTTGCTTTCAAGGGG + Intergenic
1113007686 13:105725813-105725835 AGACACTGTTTCTGTAAAATGGG + Intergenic
1113726793 13:112609751-112609773 AGACAATCATATTTTAAAAGTGG + Intergenic
1116206863 14:41878840-41878862 TTACATTGATTTTTTAAAAGTGG + Intronic
1116228200 14:42180746-42180768 ACACTCTGGTTTTTTAAAAGAGG + Intergenic
1116696584 14:48184793-48184815 AGATACTGAATGTTTAATCGTGG + Intergenic
1117235454 14:53769924-53769946 AGGAACAGATTTTTTAAAAGGGG + Intergenic
1117307884 14:54494181-54494203 AGACACTGATAGTCTAAAATGGG - Intergenic
1118173424 14:63412261-63412283 AGACCCTGTTTGTTTAAAAAAGG + Intronic
1119224548 14:72934747-72934769 AGGCACCGATTGTTTAATATGGG - Intronic
1120177171 14:81306926-81306948 AAGCACTGATTATTTAAATGGGG + Intronic
1121262549 14:92577015-92577037 AGACACTGATTCTGTAAGTGGGG - Intronic
1121630725 14:95420111-95420133 AGACACTGATTTTATAAAACAGG + Intronic
1123570251 15:21598329-21598351 TGATAGTGTTTGTTTAAAAGAGG + Intergenic
1123606362 15:22033649-22033671 TGATAGTGTTTGTTTAAAAGAGG + Intergenic
1123776616 15:23586885-23586907 AGACACTGATTGTTTTACCAAGG - Intronic
1124061676 15:26298667-26298689 AGACACTGATGGGCTAAACGAGG - Intergenic
1124199191 15:27662481-27662503 ATAACCTGATTTTTTAAAAGTGG + Intergenic
1129497778 15:76002613-76002635 AGATACAGATAGGTTAAAAGAGG + Intronic
1130621561 15:85468275-85468297 AGACTCTGACCGTCTAAAAGGGG - Intronic
1130836730 15:87657370-87657392 AGACACTGGTTGTTTAACCAAGG - Intergenic
1131677100 15:94681861-94681883 AGGCACTGATGGTTTTTAAGAGG + Intergenic
1132278214 15:100588775-100588797 AATAACTGCTTGTTTAAAAGAGG + Intronic
1202978602 15_KI270727v1_random:325420-325442 TGATAGTGTTTGTTTAAAAGAGG + Intergenic
1132459698 16:45594-45616 AAACACTGTTTGTTTACAAATGG - Intergenic
1133390859 16:5408828-5408850 CAACTCTGACTGTTTAAAAGTGG - Intergenic
1133576914 16:7100413-7100435 ATATACTGATATTTTAAAAGAGG - Intronic
1133776554 16:8900141-8900163 AGACACTCAGTGTCTGAAAGTGG - Intronic
1134637498 16:15803545-15803567 AAAAAGTGATTTTTTAAAAGAGG + Intronic
1135409845 16:22225436-22225458 AAACACTGAGTTCTTAAAAGTGG + Intronic
1137309068 16:47235345-47235367 AGAGACTAATGGTTTTAAAGTGG + Intronic
1139005415 16:62564719-62564741 AGACATTGATTATTTCAATGGGG + Intergenic
1139055349 16:63176875-63176897 AGAAACTGAGTGATTGAAAGAGG + Intergenic
1140170819 16:72601955-72601977 ATACCCTGCTTGTTTAAAATTGG - Intergenic
1140942525 16:79735257-79735279 ACACACTGATTCCTTAGAAGTGG + Intergenic
1141708772 16:85685307-85685329 AGACACTGATTTTAAACAAGGGG + Intronic
1143273838 17:5695467-5695489 AGTCACTGGTTGTATGAAAGTGG - Intergenic
1143789678 17:9284273-9284295 AGATGCTGATTTTTTAAAAAAGG - Intronic
1144452400 17:15391816-15391838 AAAATCTGGTTGTTTAAAAGAGG + Intergenic
1145853774 17:28132322-28132344 TAACATTGATTGTTTAAAATAGG + Intronic
1147592131 17:41690606-41690628 AGGCACTGAGTGTTCAAAAAAGG + Intronic
1148710271 17:49675594-49675616 AAACAATGATTTTTTAAAAAAGG + Intronic
1149222666 17:54433497-54433519 AGCCACTGAGTATATAAAAGGGG - Intergenic
1149723163 17:58865756-58865778 AGAGACTGATAGTCTAAAAAGGG - Intronic
1151741209 17:75983497-75983519 AAACACTGGTTGTCTAAAACAGG - Intronic
1153938478 18:9953761-9953783 TAACACTGATTTTTTAAAACTGG - Intronic
1154090631 18:11357749-11357771 AGATAATGAGTGTTGAAAAGTGG + Intergenic
1154402388 18:14053268-14053290 AGTAACTGATTCTTTAAAAATGG - Intergenic
1155510586 18:26572572-26572594 ACACACTGATTGATTTAAATAGG - Intronic
1156853435 18:41755067-41755089 AGACCCTGGTTGTTCAAAATGGG + Intergenic
1156933925 18:42679555-42679577 ATATACTTATTTTTTAAAAGGGG - Intergenic
1157966223 18:52211339-52211361 TCACAAAGATTGTTTAAAAGTGG + Intergenic
1158120672 18:54045012-54045034 AGAAAAATATTGTTTAAAAGTGG - Intergenic
1158841439 18:61392360-61392382 AGATACTGATTGTATATAAAAGG - Intronic
1159151890 18:64532697-64532719 AGAAACTGAATGTTTAACTGTGG - Intergenic
1159470461 18:68848812-68848834 AGTCACTGACTGTTAAAATGAGG - Intronic
1161823165 19:6543841-6543863 AAAGACTGTTTGTTTACAAGAGG + Intergenic
1162463443 19:10826879-10826901 AGACACTTTTTTTTTGAAAGAGG - Intronic
1164054275 19:21608719-21608741 AAACACTGTTTGTTTACAAATGG - Intergenic
1165952828 19:39483708-39483730 ATACATTGATTGTTTCAAACTGG + Intronic
1166868223 19:45854065-45854087 ACACACTGAGTGTGTAAATGTGG + Intronic
926965847 2:18409865-18409887 AGAAACTGATTGTGTAAAAAAGG + Intergenic
927364552 2:22278862-22278884 AGACACTGAGGCTTCAAAAGAGG - Intergenic
928498965 2:31867117-31867139 AGACACTGTTAGGTTAAAATAGG + Exonic
928662017 2:33511988-33512010 ATACACTTATTATTTAAAACAGG - Intronic
928709684 2:33990139-33990161 AGAAACTCAGTGTTTGAAAGTGG + Intergenic
928797635 2:35041149-35041171 AAAATCTGATGGTTTAAAAGTGG + Intergenic
929625961 2:43406997-43407019 AGCCACTGACTCTTTAAAGGGGG + Intronic
932483103 2:72061512-72061534 AAGATCTGATTGTTTAAAAGTGG - Intergenic
932657373 2:73621777-73621799 AAACCCTGGCTGTTTAAAAGGGG + Intergenic
933227181 2:79764147-79764169 AGACACTCAGTGTTAAAAATTGG + Intronic
936586536 2:113763258-113763280 GGCCTCTGGTTGTTTAAAAGTGG - Intergenic
936603265 2:113921299-113921321 AAACACTGATTTTTTTAAAAGGG - Intronic
937693932 2:124786827-124786849 AGAGAATAATTTTTTAAAAGCGG - Intronic
939411634 2:141834190-141834212 AGACACTGAATATTTTAAAATGG + Intronic
939667325 2:144967530-144967552 AGAGACTTAGTGTTTAAAAATGG + Intergenic
940272054 2:151901800-151901822 AAACAATGATTGCTTAAAATGGG - Intronic
944770316 2:202907553-202907575 AGACATTGATTGTTCTACAGAGG - Intronic
945442150 2:209893294-209893316 ACACACTGATTTTATAAAGGTGG - Intronic
946260433 2:218485854-218485876 AGACACAGAATTTTTAAAACTGG - Intronic
946755629 2:222944290-222944312 AGGGACTGGTTGTTTAAAAATGG - Exonic
947187130 2:227465453-227465475 TGAAACTGAGTGTTTAAGAGAGG + Intergenic
948331858 2:237174622-237174644 AGACACAAATTGTTTGAAAGTGG + Intergenic
1169546760 20:6658412-6658434 ATAAAATGATTGTTTTAAAGTGG - Intergenic
1170565898 20:17604936-17604958 GGAGACTGATTGTTTAACATTGG + Intronic
1171049757 20:21844888-21844910 AGACACAAATAGGTTAAAAGTGG + Intergenic
1174941440 20:54933303-54933325 AGACACTCATTTTTTAAAGAAGG - Intergenic
1177448951 21:21239647-21239669 AGACACTGATTCCTAAAAGGTGG + Intronic
1177815451 21:25971384-25971406 GGACACTGATTCCTGAAAAGGGG + Intronic
1184184225 22:42853611-42853633 AGACAGTGAATGTTGAGAAGAGG + Intronic
1185090400 22:48765518-48765540 AGATAGTGATTGTTTCAAGGGGG - Intronic
952401757 3:32969832-32969854 AAACACTGTTTGTTTACAAACGG - Intergenic
953051595 3:39349274-39349296 AAACACTGCTTGTTTACAAATGG - Intergenic
954757416 3:52848984-52849006 AGGCACTGACAGTTTAAAAGGGG - Intronic
956067034 3:65407637-65407659 ATAAACTCATTGTTAAAAAGTGG + Intronic
956541258 3:70342344-70342366 TGACACTGCTTGTTAATAAGTGG + Intergenic
957988681 3:87603807-87603829 AAACTCTGATTGTTTTAAGGTGG + Intergenic
958649943 3:96926185-96926207 AGAGAGTGATTGTGTGAAAGGGG + Intronic
958683999 3:97369235-97369257 AGACACTGAAAGTTTCAAATGGG + Intronic
959163313 3:102744720-102744742 AGACACTGAATTATTAAAATGGG + Intergenic
959518054 3:107291631-107291653 ATTCACTGATTATTTAAAAATGG + Intergenic
959776786 3:110174301-110174323 AGGCTCTGCTTGTTTACAAGTGG - Intergenic
961222234 3:125210448-125210470 AGACACTGAAGGTTTTAAACAGG + Intronic
961883146 3:130077303-130077325 AAACACTGATTGTCTAAAACGGG + Intergenic
961975116 3:131015897-131015919 AGGAACTGATTTTTTAAAATTGG + Intronic
962908722 3:139828294-139828316 GGACACTGATCCTATAAAAGAGG - Intergenic
962914485 3:139887246-139887268 ACACAGTGCCTGTTTAAAAGGGG + Intergenic
963646169 3:147917485-147917507 GGACACTGATTTTTTAGGAGAGG + Intergenic
963777446 3:149453299-149453321 GAAATCTGATTGTTTAAAAGTGG - Intergenic
964039071 3:152237125-152237147 ACACAGTGATTGGTTCAAAGAGG - Intergenic
964083363 3:152787313-152787335 AGACACTGATTGTTTCACCAAGG + Intergenic
964453385 3:156835092-156835114 AGAAACTGATAGTCTAAAATAGG - Intronic
966012194 3:175094148-175094170 AGACTCTGATTCATTAAAATGGG + Intronic
967388597 3:188933353-188933375 AGACACTGATTGTTTCGTAAAGG + Intergenic
968450354 4:673190-673212 AGATGCGGATTGTTTAAAAATGG - Intronic
968700226 4:2052741-2052763 AGAGACTGATAGTCTAAAGGGGG + Intergenic
969499082 4:7542189-7542211 AATCACTGATTGTTTAAGATAGG - Intronic
970340306 4:15099427-15099449 AGACGATGATTTTTTAAAACTGG + Intergenic
970367009 4:15370208-15370230 AAAAAATAATTGTTTAAAAGGGG + Intronic
970707044 4:18816743-18816765 AATAACTGATTGTTAAAAAGAGG + Intergenic
971518821 4:27523065-27523087 AAACACTGAATGTTTATATGAGG + Intergenic
972039755 4:34578271-34578293 AGAAAATGAATATTTAAAAGAGG - Intergenic
972334958 4:38099607-38099629 ATACACTCACTGTTTAAAAGTGG - Intronic
974268093 4:59611921-59611943 AGAAACTCATTGATTTAAAGTGG - Intergenic
974743182 4:66034506-66034528 TGAGATTGATTGTTTAAAAGAGG - Intergenic
974855139 4:67452392-67452414 AAGAACTGATGGTTTAAAAGTGG + Intergenic
974934681 4:68398252-68398274 AAACATTGATTGTGTAAAACAGG + Intergenic
976280540 4:83322680-83322702 AGGGAATCATTGTTTAAAAGAGG + Intronic
976433804 4:84993868-84993890 AAATAATTATTGTTTAAAAGAGG + Intergenic
976500030 4:85776703-85776725 AGTCACAGATTGTTTAGAACAGG - Intronic
976772631 4:88670475-88670497 ATACTCTGATTTTTTTAAAGGGG - Intronic
978950959 4:114558742-114558764 AATAACTGGTTGTTTAAAAGAGG - Intergenic
979739979 4:124137539-124137561 AGATCTTGATGGTTTAAAAGTGG + Intergenic
979818211 4:125137149-125137171 AGACACTGAAATGTTAAAAGTGG + Intergenic
980468962 4:133225401-133225423 AGACACTGATTTTTAAAATTGGG + Intergenic
981985851 4:150854957-150854979 AGCCACTGATCTTTTAAAAAGGG - Intronic
982590805 4:157307317-157307339 TGTCTCTAATTGTTTAAAAGTGG - Intronic
982827343 4:160017851-160017873 AGTCACTGAGGGTTTAAAAGAGG + Intergenic
983857618 4:172664902-172664924 ACAACCTGATTGTGTAAAAGGGG + Intronic
984584261 4:181545280-181545302 AGGCACTGTTTGTTATAAAGGGG - Intergenic
984656343 4:182322758-182322780 AGACACTGATTCTTTGAGAGAGG + Intronic
986345112 5:6827471-6827493 AAACACTCATTGCATAAAAGAGG - Intergenic
988579649 5:32458051-32458073 AAAATCTGATGGTTTAAAAGTGG - Intergenic
989774637 5:45189301-45189323 AAATATTGATTTTTTAAAAGTGG - Intergenic
990133541 5:52617601-52617623 AATCAAGGATTGTTTAAAAGGGG - Intergenic
990746227 5:58961832-58961854 AGCCATTGATTGTTTTAGAGTGG - Intergenic
992713420 5:79484677-79484699 AGACACCTATAGGTTAAAAGAGG + Intronic
994121118 5:96114048-96114070 ATACACTTATTGTTGAAAAATGG - Intergenic
994328844 5:98482237-98482259 TGACATTGATGGCTTAAAAGTGG + Intergenic
994826911 5:104724796-104724818 AGCCACTGTTTGTGTAAGAGTGG + Intergenic
995102898 5:108336670-108336692 AGAAAATGATTTCTTAAAAGTGG - Intronic
995802595 5:116014666-116014688 AAACACTGGTTTTTTAAAAAAGG - Intronic
996908277 5:128627008-128627030 AGAAAATGATTTTTTAAATGTGG + Intronic
998083762 5:139299160-139299182 ATACATTGAATGATTAAAAGGGG + Intronic
998246076 5:140506467-140506489 AGAAACAGATTTTTTAAAAGGGG - Intronic
998887442 5:146709076-146709098 AGACACTGATTGGATGACAGAGG - Intronic
999096482 5:148982736-148982758 AGAAACTAATTTTTTAAATGTGG + Intronic
999460094 5:151750231-151750253 TGAGACTGATTGTTCAAAAGAGG + Intronic
999550464 5:152680863-152680885 AGAAACTGATCATTTAAAGGGGG + Intergenic
999813985 5:155157340-155157362 GAACACTGATTGTCTATAAGAGG + Intergenic
1000481567 5:161782681-161782703 TAAAACTGATTTTTTAAAAGTGG + Intergenic
1001013083 5:168116131-168116153 AGAGGCTGATTGTCTAACAGAGG - Intronic
1001684635 5:173584299-173584321 AGACACTTTTTGTCCAAAAGGGG + Intergenic
1002614670 5:180443701-180443723 AGACCCTGTTTTTTAAAAAGAGG - Intergenic
1003424145 6:5985699-5985721 AGGCACTGATTATTTCAAAATGG + Intergenic
1004279651 6:14269950-14269972 AGACACTGCTGGTGTATAAGTGG - Intergenic
1004436750 6:15602915-15602937 AGACATTTATTATTTAAAAATGG + Intronic
1004661355 6:17712741-17712763 AGTCACTGTTTGTTTAAACTGGG - Intergenic
1004743446 6:18486500-18486522 AGACACTGATGTGTTAGAAGAGG + Intergenic
1007148089 6:39657534-39657556 TGACACTGCTTGTTAAAATGTGG - Intronic
1009632039 6:66212692-66212714 AGAAACTGGTTGTTTTAAAAAGG + Intergenic
1010398351 6:75418771-75418793 TAACACTGATTTTTTAAAAAGGG - Intronic
1010783936 6:79978085-79978107 AGACACTGCCTCTATAAAAGGGG - Intergenic
1010908233 6:81519930-81519952 AGAGACTGATTCTTTAACAGGGG - Intronic
1012317035 6:97793498-97793520 ATACACTGTATGTTTTAAAGAGG + Intergenic
1014570451 6:123000834-123000856 ACACACTGTTTCTTTAAAACAGG - Intronic
1015497358 6:133895310-133895332 AAACATTGATTGTTAAAATGTGG - Exonic
1016271320 6:142293691-142293713 AGACCTTGATGGTTTAAAAGTGG - Intergenic
1016854509 6:148653237-148653259 AATGACTGGTTGTTTAAAAGAGG + Intergenic
1016868566 6:148794541-148794563 GGACACTGACTTTTTAAAAAAGG - Intronic
1021130324 7:16904349-16904371 AAAGACTGTTTCTTTAAAAGTGG + Intergenic
1021996985 7:26188583-26188605 TGTCACTGATGGTTGAAAAGTGG - Intergenic
1023145855 7:37150369-37150391 ACACACTGATTGTGTGAATGTGG - Intronic
1024407381 7:48998138-48998160 AGACTCTGAGTGTTCAGAAGTGG - Intergenic
1027976224 7:85159337-85159359 AGTCAATGACTGTTAAAAAGGGG - Intronic
1028486294 7:91361280-91361302 AAGCACTGTTTGTTTTAAAGAGG + Intergenic
1028748509 7:94355293-94355315 AGACTCTAATTGTTTTGAAGGGG - Intergenic
1030207277 7:106963228-106963250 AAACACAGTATGTTTAAAAGAGG + Intergenic
1031112523 7:117629533-117629555 AGTCACTGATTGGTTAACATTGG + Intronic
1031532270 7:122889037-122889059 AGACGTTTATGGTTTAAAAGTGG + Intergenic
1032612816 7:133434074-133434096 AGACAATCATTATTTTAAAGAGG - Intronic
1032726620 7:134595560-134595582 AAAATCTGATGGTTTAAAAGTGG - Intergenic
1033430401 7:141283909-141283931 AGAATCTGATTATTGAAAAGTGG + Intronic
1033723485 7:144086564-144086586 ATACTCTGATTACTTAAAAGAGG - Intergenic
1034731845 7:153393759-153393781 AATTACTGATTGTTTAAAAGAGG + Intergenic
1037153527 8:15670847-15670869 AGACAGTGAAATTTTAAAAGAGG + Intronic
1037961188 8:23099454-23099476 AAACATTGATTGTCTAAAATGGG - Intronic
1037970489 8:23168403-23168425 AAACATTGATTGTCTAAAATGGG + Intergenic
1038928502 8:32167347-32167369 AGACACTGAGGATATAAAAGTGG - Intronic
1043491441 8:80753051-80753073 AAACACAGATTGTTTATAAAAGG - Intronic
1043668629 8:82851429-82851451 ACATGCTGATTGTTTACAAGTGG + Intergenic
1043913397 8:85891232-85891254 GGACTCTGCTTGTTTAAAAAAGG + Intergenic
1044082503 8:87903156-87903178 AGTAACTGATTTTTAAAAAGTGG - Intergenic
1044781179 8:95744864-95744886 AGTCACTGAGTGTATAAAATAGG + Intergenic
1045649799 8:104330842-104330864 AGACCTTGATGGCTTAAAAGTGG + Intronic
1045730690 8:105236784-105236806 AGACAATTATATTTTAAAAGTGG - Intronic
1046120196 8:109836578-109836600 AGAAAATGATTATTTAAAATAGG - Intergenic
1046303412 8:112328768-112328790 AGACAGTGAGTGTGTAAAGGAGG - Intronic
1046906334 8:119577373-119577395 AGACACTGAATATTTTAAATGGG + Intronic
1046948058 8:119993057-119993079 AGAAGCTGATTACTTAAAAGGGG - Intronic
1047537536 8:125733437-125733459 AGAGGCTCATTATTTAAAAGAGG + Intergenic
1048491371 8:134896796-134896818 AGGATCTGGTTGTTTAAAAGTGG - Intergenic
1050128802 9:2388121-2388143 AAACACTTATTGTATATAAGTGG + Intergenic
1050526208 9:6549006-6549028 AGACGCTGGGTGTTTAAAATGGG - Intronic
1051251201 9:15160806-15160828 AGACACTGATTGAACAGAAGTGG - Intergenic
1051527507 9:18063528-18063550 AGACATTCATTGTTCAAAACAGG + Intergenic
1052406130 9:28063683-28063705 AAAGACTGATTGTTTGAGAGTGG - Intronic
1052486780 9:29111127-29111149 ATACAGTGATTTTTTAAAAAAGG - Intergenic
1052898528 9:33770232-33770254 AGACATTTCTAGTTTAAAAGTGG - Intronic
1055534646 9:77227248-77227270 AAACACTGAATGTTTGAATGGGG - Intronic
1057174222 9:92984255-92984277 AATAACTGGTTGTTTAAAAGAGG - Intronic
1057451482 9:95165543-95165565 ACTCACTGGTTGTTTAAGAGTGG + Intronic
1058557077 9:106180994-106181016 AGACAATGGTTGCCTAAAAGGGG - Intergenic
1058636360 9:107042207-107042229 AAAATCTGATTGTTAAAAAGAGG + Intergenic
1059605114 9:115825697-115825719 AAAATCTGGTTGTTTAAAAGTGG + Intergenic
1059625001 9:116054148-116054170 AGACATTCAATGTTTAAAAACGG - Intergenic
1060460731 9:123852073-123852095 AGACACTGATTGTTTAAAAGGGG - Intronic
1062665008 9:137665775-137665797 GAACACTGATTGTTTTAAAATGG + Intronic
1186253137 X:7690803-7690825 AGACACGGGCTCTTTAAAAGAGG + Intergenic
1186765668 X:12768263-12768285 AAACACCGATGGTTTAAAACAGG - Intergenic
1188515036 X:30976125-30976147 AGCCACTGTTTTTTAAAAAGTGG + Intergenic
1188532359 X:31156215-31156237 AGGCTCTGAATGTTTTAAAGGGG - Intronic
1190487507 X:50942455-50942477 ACACACTCATTTTGTAAAAGTGG + Intergenic
1194438725 X:93902023-93902045 AATATCTGATTGTTTAAAAGTGG + Intergenic
1195309857 X:103621861-103621883 ATACATTGATTGATTAAAATTGG - Intronic
1195566207 X:106342051-106342073 ATACACTGATTGTTTAATAAAGG - Intergenic
1196400893 X:115315064-115315086 AATAACTGGTTGTTTAAAAGAGG - Intergenic
1198120833 X:133590963-133590985 AGAAACTGACTTTTCAAAAGTGG + Intronic
1198519776 X:137441115-137441137 AGATACTGATTGATTCAAAATGG + Intergenic
1201451528 Y:14120799-14120821 AAAAACTGATTGTTTAAAAGTGG + Intergenic
1202071208 Y:20993422-20993444 AAACACTGTTTGTTTACAAATGG - Intergenic
1202085783 Y:21135335-21135357 AAACACTGATTGTCTAAAATGGG - Intergenic