ID: 1060460732

View in Genome Browser
Species Human (GRCh38)
Location 9:123852074-123852096
Sequence AAGACACTGATTGTTTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 378}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060460732_1060460737 17 Left 1060460732 9:123852074-123852096 CCCTTTTAAACAATCAGTGTCTT 0: 1
1: 0
2: 3
3: 35
4: 378
Right 1060460737 9:123852114-123852136 CTGTCCCGCCATTACACTCTGGG No data
1060460732_1060460738 18 Left 1060460732 9:123852074-123852096 CCCTTTTAAACAATCAGTGTCTT 0: 1
1: 0
2: 3
3: 35
4: 378
Right 1060460738 9:123852115-123852137 TGTCCCGCCATTACACTCTGGGG No data
1060460732_1060460743 29 Left 1060460732 9:123852074-123852096 CCCTTTTAAACAATCAGTGTCTT 0: 1
1: 0
2: 3
3: 35
4: 378
Right 1060460743 9:123852126-123852148 TACACTCTGGGGAAGAGTGGTGG No data
1060460732_1060460742 26 Left 1060460732 9:123852074-123852096 CCCTTTTAAACAATCAGTGTCTT 0: 1
1: 0
2: 3
3: 35
4: 378
Right 1060460742 9:123852123-123852145 CATTACACTCTGGGGAAGAGTGG No data
1060460732_1060460736 16 Left 1060460732 9:123852074-123852096 CCCTTTTAAACAATCAGTGTCTT 0: 1
1: 0
2: 3
3: 35
4: 378
Right 1060460736 9:123852113-123852135 CCTGTCCCGCCATTACACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060460732 Original CRISPR AAGACACTGATTGTTTAAAA GGG (reversed) Intronic
901471167 1:9457413-9457435 AAAGCACTGTGTGTTTAAAAGGG - Intergenic
907187403 1:52620358-52620380 AAGACACTGATTCTAGGAAAGGG + Intergenic
907236253 1:53051323-53051345 AATACACTGATTTTTCAATAAGG - Exonic
908232464 1:62119351-62119373 AAGATCCTGATTTTTTAAATGGG - Intronic
908707440 1:66974753-66974775 AGGACAGTAATTCTTTAAAAGGG + Intronic
909088569 1:71197096-71197118 AATAAATTGATTTTTTAAAATGG - Intergenic
909228221 1:73052930-73052952 AACAAACTGATTTTTTAAATGGG + Intergenic
909946077 1:81664449-81664471 ATGTCACTGATTGTTTCAGAAGG - Intronic
910109927 1:83672216-83672238 AAGACACTGATAGTACAAAGTGG - Intergenic
912064807 1:105724053-105724075 AAATCCTTGATTGTTTAAAAAGG + Intergenic
912145825 1:106792952-106792974 TAGACACTGATCTTTCAAAAGGG + Intergenic
912541322 1:110418083-110418105 AAGACACTGAAGTTTTAAAAAGG - Intergenic
912570069 1:110614907-110614929 ATGTCACTGCCTGTTTAAAAGGG + Intronic
912910749 1:113757210-113757232 AAGCCAGTGATTGAATAAAATGG + Intronic
913354648 1:117906027-117906049 AATAAACTGATTTTCTAAAATGG + Intronic
913692784 1:121295297-121295319 AAACCACTGATGGTTTAAATAGG + Intronic
916776830 1:167975343-167975365 AAGCAAGCGATTGTTTAAAAGGG - Intronic
916825364 1:168437319-168437341 AATACACTGAGTGTTCAACATGG + Intergenic
916908001 1:169309908-169309930 CAGAAAATGATTTTTTAAAAAGG + Intronic
917257914 1:173135508-173135530 AAGAGACTGATTATTTACAAGGG - Intergenic
917820537 1:178758898-178758920 AATACTCTGATTTTTTAAATGGG - Intronic
919005494 1:191894012-191894034 AAGACACTAAACGTTAAAAAGGG + Intergenic
919298904 1:195735764-195735786 AAATAACTGGTTGTTTAAAAAGG + Intergenic
919309574 1:195891063-195891085 AAGACAGAAATTATTTAAAAAGG + Intergenic
919508409 1:198429447-198429469 AAGAGACTGATGGTTTAGAAGGG - Intergenic
919837539 1:201585624-201585646 AAAAAACTGATTTTTTAAATGGG + Intergenic
920123111 1:203673484-203673506 AAGACAGTGCTTATTAAAAAAGG - Intronic
920480105 1:206313662-206313684 AAACCACTGATGGTTTAAATAGG + Intronic
921659718 1:217787148-217787170 AAGACAGTGATAGTATAAAGGGG - Intronic
923487343 1:234446442-234446464 AAGACAGTGATCATTTTAAATGG + Intronic
1062774358 10:133656-133678 AAGTAACAGACTGTTTAAAAAGG + Intergenic
1066593892 10:37027314-37027336 GAGACATTGATAGTTTAAACGGG + Intergenic
1066596811 10:37060068-37060090 GAAACATTGATTGTGTAAAAAGG - Intergenic
1068520555 10:58072774-58072796 AAGAAAATAATTATTTAAAAGGG + Intergenic
1068761227 10:60711972-60711994 AAGAAAATTATTCTTTAAAAAGG + Intronic
1068783868 10:60948706-60948728 CAAACACTTATTCTTTAAAATGG - Intronic
1068808883 10:61232908-61232930 AATAAAATGATTGTTTAAGAAGG + Intergenic
1069879754 10:71584515-71584537 AATACACTGATTGCTTTGAAGGG + Intronic
1070263484 10:74880332-74880354 AAGCCAGTGATTTTTAAAAAAGG - Intronic
1070827729 10:79400996-79401018 AAGGGACTCATTGTCTAAAAGGG - Intronic
1071918958 10:90327982-90328004 AATACACAGATTGTTAAAAAGGG + Intergenic
1072291486 10:93969674-93969696 AAGTCACTGATTATATAAAATGG + Intergenic
1073810703 10:107149577-107149599 AAGATAGTGATGCTTTAAAATGG + Intronic
1074431927 10:113401630-113401652 AAGACACAGATTGTCTAACTAGG - Intergenic
1074503778 10:114048727-114048749 AAGACATTGAGTGTGCAAAAAGG + Intergenic
1074677161 10:115864489-115864511 AAGACATTTATTGATTACAAAGG + Intronic
1075318857 10:121473309-121473331 AAGTGAATGCTTGTTTAAAAAGG + Intergenic
1078596140 11:12688283-12688305 AAGACACTGGGTCTTTGAAATGG + Intronic
1080236647 11:30076723-30076745 AAGTCACTAATTATTTAAAAAGG - Intergenic
1081014246 11:37856348-37856370 AAAAATCTGATTGTTAAAAAGGG - Intergenic
1081375523 11:42353524-42353546 AGGACACTGATTGTTGAGGAGGG + Intergenic
1082112340 11:48291236-48291258 AAATAACTGATTGCTTAAAAAGG + Intergenic
1083129424 11:60610562-60610584 AAGACAATGATTGATCATAAAGG - Intergenic
1083525302 11:63359422-63359444 AAGAAAAAGATTTTTTAAAAAGG - Intronic
1084233563 11:67770946-67770968 CAAACCCTGGTTGTTTAAAACGG + Intergenic
1084380395 11:68808247-68808269 AAGAAACGGACTGTGTAAAACGG + Intronic
1084977052 11:72806999-72807021 AGAGAACTGATTGTTTAAAAAGG - Intergenic
1085027685 11:73246279-73246301 AAGAAACCGATTTTTAAAAATGG - Intergenic
1085892801 11:80601066-80601088 GAAACATTGATTGTGTAAAAAGG + Intergenic
1085894416 11:80621002-80621024 GAGACACTGATAGTTTAAATGGG - Intergenic
1086032560 11:82377756-82377778 CAGATACAGAGTGTTTAAAATGG - Intergenic
1086534349 11:87826074-87826096 AAGACAATAGATGTTTAAAATGG + Intergenic
1086943499 11:92822100-92822122 AAGAAACTGGATGTTTAAAAGGG - Intronic
1087042872 11:93818975-93818997 AAGGCACTGCTTGATTCAAAAGG - Exonic
1088223755 11:107596024-107596046 ATGAGACTGATTTTTTAAAAAGG - Intronic
1088296356 11:108299983-108300005 AAGACACTGAGATTTAAAAAAGG - Intronic
1090047960 11:123352592-123352614 AAGACGCTGATTCTTAACAAAGG - Intergenic
1091194447 11:133719436-133719458 AAGACTCTGTCTCTTTAAAAAGG + Intergenic
1093210719 12:16305142-16305164 ACTACTCTGATTCTTTAAAAAGG + Intergenic
1093334739 12:17889993-17890015 AACAAATTGCTTGTTTAAAAGGG - Intergenic
1093472572 12:19519362-19519384 AAGACATTTATTGTTAAAGAAGG - Exonic
1093803536 12:23403349-23403371 AAGAAACGGATTGTGTACAAGGG - Intergenic
1094082227 12:26549936-26549958 CAGTTACTCATTGTTTAAAAAGG + Intronic
1094145533 12:27225024-27225046 AAGTGACTGAATGCTTAAAAGGG - Intergenic
1095769357 12:45935450-45935472 GATACGCTGATTTTTTAAAATGG + Intronic
1097165915 12:57086757-57086779 AAGTCAATGATTTTTTAAATAGG + Intronic
1097373903 12:58818054-58818076 AAAACACTGGTTTTTTTAAAGGG - Intergenic
1098096228 12:66959232-66959254 ATGAAAGTTATTGTTTAAAAAGG - Intergenic
1098184229 12:67879219-67879241 AAAACATTGGTTGTCTAAAATGG + Intergenic
1098446967 12:70575980-70576002 AACACACTGGCTGTTTAACAAGG + Intronic
1098490548 12:71071211-71071233 AATAAATTGATTGATTAAAATGG - Intronic
1099148606 12:79079298-79079320 AATACACTGAGTGATTTAAATGG + Intronic
1102072853 12:110036016-110036038 AAGAGACTGATTTTGTACAAAGG + Intronic
1102199591 12:111048166-111048188 AAGATACTGAGGGTCTAAAACGG + Intronic
1102414584 12:112749488-112749510 AAAACGCTGAATCTTTAAAATGG - Intronic
1106007450 13:25784170-25784192 TAGGCATTGATGGTTTAAAAAGG + Intronic
1106287535 13:28330663-28330685 AAGTCTCTGATTTATTAAAAGGG - Intronic
1106650717 13:31687354-31687376 AAAACACAGATTGTCTGAAAAGG + Intergenic
1107426877 13:40302984-40303006 AAGAGACTGATGGTCTAACATGG - Intergenic
1108509491 13:51142842-51142864 AAGTAACTGGTTGTTTAAAAAGG + Intergenic
1109882969 13:68506389-68506411 AAGACATTAATGTTTTAAAATGG + Intergenic
1110051144 13:70901486-70901508 AAGAAAGTGATGGTTCAAAAAGG + Intergenic
1111130863 13:83973721-83973743 AAAACAATGATTTGTTAAAATGG + Intergenic
1111440215 13:88272653-88272675 GAGAAACTGATTGTTCAAGAGGG + Intergenic
1111519121 13:89376610-89376632 AAGATGTTGACTGTTTAAAATGG + Intergenic
1112806859 13:103172625-103172647 AAGACACTGCTTGCTTTCAAGGG + Intergenic
1112950831 13:104994430-104994452 TAGGCAATGATTTTTTAAAATGG - Intergenic
1113007685 13:105725812-105725834 CAGACACTGTTTCTGTAAAATGG + Intergenic
1113093157 13:106636032-106636054 AAGACCCTATTTTTTTAAAAAGG + Intergenic
1114847004 14:26334615-26334637 AAAACACTGAAGGTTTTAAATGG - Intergenic
1114886324 14:26856421-26856443 AAGAAACTGCTTGTGAAAAATGG + Intergenic
1115099516 14:29681582-29681604 CAGTCAATGCTTGTTTAAAATGG + Intronic
1116126366 14:40792453-40792475 CACACACTGATAGTTTCAAATGG - Intergenic
1116429699 14:44831508-44831530 AAGACACTGAGTTTTTGAGATGG + Intergenic
1117307885 14:54494182-54494204 AAGACACTGATAGTCTAAAATGG - Intergenic
1118427853 14:65686710-65686732 AAGAAACTGTTTTTTTAAGAGGG + Intronic
1119132742 14:72189996-72190018 AAGAAACTGAGGGTTTAAAAAGG - Intronic
1119224549 14:72934748-72934770 GAGGCACCGATTGTTTAATATGG - Intronic
1120030995 14:79640848-79640870 AAGAGACTGATAGTCTTAAATGG + Intronic
1120320139 14:82949256-82949278 AAGCCATTGATTGCTGAAAAGGG + Intergenic
1120956109 14:90083691-90083713 AAGACACTGACAGTTTGAAAGGG - Intronic
1121147543 14:91598083-91598105 AAATAACTGGTTGTTTAAAAAGG - Intronic
1121418725 14:93797518-93797540 GAGACACGGATGGTTTTAAAGGG - Intergenic
1121806124 14:96824954-96824976 AAAACATTAATTTTTTAAAATGG + Intronic
1122333254 14:100943002-100943024 TAGAGACTTATTTTTTAAAAAGG + Intergenic
1122394881 14:101417936-101417958 AGAACACTGATTTTTTCAAAGGG - Intergenic
1122461607 14:101900309-101900331 ATTACAGTGATTTTTTAAAAAGG - Intronic
1123769710 15:23516806-23516828 AAGAGACTGATGGTCTAAAATGG - Intergenic
1124876138 15:33595981-33596003 AAATCACTGATTTTTTAAAAAGG - Intronic
1126712477 15:51474997-51475019 AAGATACTGATTAATTACAAAGG + Intronic
1127322466 15:57860414-57860436 AAGACACTTATTACTTATAAAGG - Intergenic
1127405425 15:58639744-58639766 AAGATACTGACTTTTAAAAAAGG + Intronic
1127510980 15:59641012-59641034 AAGAGACTATTTCTTTAAAAAGG + Intronic
1127804235 15:62504006-62504028 ATGCCACTGATTTTTTTAAAAGG - Intronic
1128338929 15:66806393-66806415 AAGACACAGACTCTTTAAGAAGG + Intergenic
1128485617 15:68084385-68084407 AAGACTTTTATTATTTAAAAAGG - Intronic
1130621562 15:85468276-85468298 AAGACTCTGACCGTCTAAAAGGG - Intronic
1131885594 15:96908317-96908339 AAGAGCGTGATTGTCTAAAATGG + Intergenic
1133183589 16:4078246-4078268 GATAAACTGATTTTTTAAAATGG + Intronic
1134221418 16:12357674-12357696 CAGGCACTGACTGTTTAAAGGGG - Intronic
1134661556 16:15988302-15988324 AAGAGACAGATGGTTTAGAAAGG - Intronic
1137307444 16:47217209-47217231 AATGCACTGATGGCTTAAAATGG - Intronic
1137916620 16:52438441-52438463 AAAACACTGTATTTTTAAAAGGG - Exonic
1139005414 16:62564718-62564740 AAGACATTGATTATTTCAATGGG + Intergenic
1139174293 16:64669014-64669036 AAGACCCCGAATGTATAAAAAGG - Intergenic
1143547495 17:7606751-7606773 ATGACACTGATAATTTATAAAGG + Intronic
1144229008 17:13180799-13180821 AAGACTCAGATTTTTTTAAATGG - Intergenic
1147395456 17:40139344-40139366 AACACACTGATTCTTTTCAATGG + Intergenic
1149145571 17:53488359-53488381 AAGAAACTGAATGTTTCTAATGG - Intergenic
1149723164 17:58865757-58865779 AAGAGACTGATAGTCTAAAAAGG - Intronic
1149776466 17:59361741-59361763 AAGATACTGTTGGTTAAAAAAGG + Intronic
1150722499 17:67625523-67625545 AAGCCACTGCTTGTTTTTAATGG + Intronic
1150972731 17:70047759-70047781 AAGGCATTGTTTGTTTTAAAAGG + Intergenic
1153099421 18:1449752-1449774 AACACACTTATGGGTTAAAAAGG - Intergenic
1153647525 18:7208437-7208459 AAGACACTGAAGTTTTAAATTGG - Intergenic
1153924271 18:9820831-9820853 AAAACACTGGTTCTTTGAAAAGG - Intronic
1154005156 18:10521076-10521098 AAGAGAATGAATGTTTGAAAAGG - Intergenic
1154065735 18:11105280-11105302 AAGGCACTGAGTGTGTCAAATGG - Intronic
1155323289 18:24640330-24640352 AAGACACTGATTATTTTACCAGG - Intergenic
1155713807 18:28914225-28914247 AAGAGACTGTTGGTCTAAAATGG + Intergenic
1155811563 18:30242351-30242373 AATTAACTGATTTTTTAAAATGG + Intergenic
1156853434 18:41755066-41755088 GAGACCCTGGTTGTTCAAAATGG + Intergenic
1156933926 18:42679556-42679578 AATATACTTATTTTTTAAAAGGG - Intergenic
1157013127 18:43677211-43677233 AACCCACTGATTTTTTAGAAAGG + Intergenic
1158214193 18:55082348-55082370 AAGCCACCTATTTTTTAAAATGG + Intergenic
1159844431 18:73441376-73441398 AAGACTCTGACTTTTAAAAAGGG - Intergenic
1164463653 19:28469658-28469680 AAGACACTGAGTGTTACACATGG + Intergenic
1165335611 19:35167553-35167575 GAGAAACTAATTTTTTAAAAAGG + Intronic
1165910671 19:39224736-39224758 AAGACCCTGTTTTTTAAAAAAGG + Intergenic
925232631 2:2248087-2248109 ATGAAACTGTTTTTTTAAAAAGG + Intronic
927601824 2:24449592-24449614 TAGTCAGTGATTTTTTAAAAGGG + Intergenic
927688603 2:25191084-25191106 AAGACAGTAGATGTTTAAAATGG + Intergenic
931847033 2:66214596-66214618 ATGACAGAGATTATTTAAAATGG - Intergenic
933911388 2:86943639-86943661 AATACCCTAAATGTTTAAAATGG - Intronic
934745332 2:96756033-96756055 CAGACACTGAGTATTTATAAAGG - Intergenic
935202273 2:100868375-100868397 AAAACACTGATTATCTAATAAGG - Intronic
935562411 2:104572795-104572817 AAGCTTCTGATTGTTTCAAATGG - Intergenic
935991258 2:108720676-108720698 AATACCCTAAATGTTTAAAATGG - Intronic
936603266 2:113921300-113921322 AAAACACTGATTTTTTTAAAAGG - Intronic
936933540 2:117815062-117815084 AAGACACTGATTGCTCAGAAAGG - Intronic
939560311 2:143723768-143723790 AACACAGTGATCCTTTAAAACGG - Intronic
939816215 2:146900492-146900514 AAGACAATGATTGATTCAAGAGG + Intergenic
940272055 2:151901801-151901823 AAAACAATGATTGCTTAAAATGG - Intronic
941553322 2:166943421-166943443 AAGACAGTGATATTTTAAAGTGG - Intronic
941613970 2:167697697-167697719 TAGGTACTGATTGTTTGAAAAGG + Intergenic
941743993 2:169066950-169066972 AAGGCATTGTTTGTATAAAAAGG + Intronic
942479591 2:176369708-176369730 AACCCACTCATAGTTTAAAAAGG + Intergenic
942723386 2:178979703-178979725 AAATCACTGATGCTTTAAAATGG + Intronic
942782246 2:179658111-179658133 AAGATACATATTTTTTAAAAGGG - Intronic
943172851 2:184425903-184425925 AAGACACTGACTCTTAAAACTGG - Intergenic
943188382 2:184644723-184644745 AAGATACTGATTGCTCAAAGAGG + Intronic
943739395 2:191395133-191395155 AAGACATTTATTAATTAAAAAGG + Intronic
944003742 2:194876463-194876485 AAGAGACCTATTGTATAAAATGG - Intergenic
945004285 2:205387197-205387219 AAAACAATGATTATTTAAGAAGG - Intronic
947453552 2:230231520-230231542 AAGAAACAGACTATTTAAAAAGG - Intronic
948810201 2:240471127-240471149 CAGCCACTGATTCTTCAAAAAGG - Intergenic
1168844097 20:930849-930871 AAGAAACTGAGATTTTAAAAGGG - Intergenic
1169561039 20:6801386-6801408 AATCCACTGAGTGTTTTAAATGG + Intergenic
1169709190 20:8542374-8542396 AACAAACTTATTGTTTAAAATGG - Intronic
1169850286 20:10041532-10041554 AAGGTACTTATTATTTAAAAGGG - Intronic
1170955491 20:20975532-20975554 AAGACACTTATTAATTACAAAGG + Intergenic
1171327371 20:24306703-24306725 AAGACCCCGATTTTTAAAAATGG - Intergenic
1171511411 20:25687873-25687895 GAGAGCCTCATTGTTTAAAAAGG - Intronic
1174981333 20:55398793-55398815 AAGGCCCTGAAAGTTTAAAAAGG + Intergenic
1175089595 20:56491021-56491043 AAAACACAGCTTGTTAAAAAGGG - Intronic
1175568478 20:59999975-59999997 AAGACACTTTTTTCTTAAAATGG + Intronic
1177563530 21:22787547-22787569 AACACACTGTGTATTTAAAATGG - Intergenic
1177612576 21:23471069-23471091 AAAACCATGATTTTTTAAAAAGG - Intergenic
1177776085 21:25567821-25567843 AAGACAATGAATTTTTAAAAAGG + Intergenic
1177815450 21:25971383-25971405 AGGACACTGATTCCTGAAAAGGG + Intronic
1179001353 21:37462472-37462494 AAGACATTGAGTGTTCAAACAGG - Intronic
1179063164 21:37998777-37998799 AAGACTCTGAATATATAAAATGG - Intronic
1179080975 21:38170444-38170466 CAGGCACTGATTGTTTCTAAGGG + Intronic
1179116273 21:38495545-38495567 AAGATACTTAATGTGTAAAAAGG - Intronic
1179677694 21:42995372-42995394 AAGACACTTATTAATTACAAAGG - Intronic
1181619092 22:24075997-24076019 AAGTCACTACTTATTTAAAAAGG + Intronic
1182378555 22:29867461-29867483 GAGACACTGTCTCTTTAAAAAGG + Intergenic
1184818405 22:46889943-46889965 ACCAAACTGATTGCTTAAAATGG + Intronic
1184843635 22:47067277-47067299 AAGAGACAGAGTGGTTAAAATGG - Intronic
1185090401 22:48765519-48765541 AAGATAGTGATTGTTTCAAGGGG - Intronic
949464664 3:4332273-4332295 AAGAGACTGATAGTCTAAAGTGG - Intronic
949636545 3:5988412-5988434 AAGACTCAGATTGATTTAAATGG + Intergenic
949783772 3:7718387-7718409 AACTCACTGACTGTTTATAAAGG + Intronic
950082429 3:10232578-10232600 AAGACACCTAGTGTTTAAACAGG - Intronic
950825873 3:15820488-15820510 AATACATTCATTTTTTAAAAGGG + Intronic
951513406 3:23529679-23529701 AAGCCACTCATTGGTTAAATTGG + Intronic
953269789 3:41430101-41430123 AACACATTTATTCTTTAAAAGGG + Intronic
954757417 3:52848985-52849007 AAGGCACTGACAGTTTAAAAGGG - Intronic
956356619 3:68400600-68400622 AAGAATCTGATTGTTTAGAGAGG - Intronic
956900643 3:73712370-73712392 AAGACACTTATTAATTACAAAGG - Intergenic
956953885 3:74314430-74314452 AAGACACACATAGATTAAAAGGG + Intronic
957225994 3:77447666-77447688 AAGACACTAATTAGTTCAAAAGG - Intronic
957494369 3:80971856-80971878 ACGACACTGCTGGTTTACAAAGG - Intergenic
957509652 3:81170710-81170732 AACTCACTGATTATTTAATAAGG - Intergenic
958587756 3:96113089-96113111 AAAAAACTGATTGAATAAAAGGG - Intergenic
958683998 3:97369234-97369256 AAGACACTGAAAGTTTCAAATGG + Intronic
958768621 3:98400319-98400341 AAAAAACTGATTCTTTAAAAAGG + Intergenic
959163312 3:102744719-102744741 TAGACACTGAATTATTAAAATGG + Intergenic
960362321 3:116728509-116728531 AAGATGCTGTTTGTTTTAAAGGG - Intronic
960421327 3:117449107-117449129 AAGAAACTGTTTGTTTAAGAAGG - Intergenic
961883145 3:130077302-130077324 CAAACACTGATTGTCTAAAACGG + Intergenic
962452148 3:135528984-135529006 AAGACAGTGATGATATAAAACGG - Intergenic
963221343 3:142816289-142816311 AGAAAAATGATTGTTTAAAAAGG + Intronic
963615071 3:147526655-147526677 CAGACAATGATTTTTTAAAAAGG - Intergenic
964428608 3:156579910-156579932 AAGGCACTGTCTGTTTATAAGGG + Intergenic
964525636 3:157613161-157613183 AAGACAGAGATTTTTTTAAACGG + Intronic
965474836 3:169144004-169144026 AACATACTGCTTTTTTAAAAAGG + Intronic
966012193 3:175094147-175094169 GAGACTCTGATTCATTAAAATGG + Intronic
966277640 3:178194704-178194726 AAACCACTGGGTGTTTAAAATGG + Intergenic
967572560 3:191047338-191047360 AAGACACAAATTGTTAAAACCGG - Intergenic
967903834 3:194485748-194485770 AAGACACTGATGATTAAAAGCGG + Intronic
968700225 4:2052740-2052762 AAGAGACTGATAGTCTAAAGGGG + Intergenic
971110123 4:23575562-23575584 AAGAGACAGATTGTTTGGAAAGG - Intergenic
971183660 4:24353174-24353196 AAAAGATTGATTATTTAAAAGGG - Intergenic
972853591 4:43079299-43079321 AAATAACTGGTTGTTTAAAAAGG - Intergenic
973272519 4:48276139-48276161 ATGAAAATGTTTGTTTAAAAGGG - Intergenic
973652931 4:53014812-53014834 AGGACACTGTTTTTTTCAAAAGG - Intronic
975431992 4:74304463-74304485 AAGACACAGAGTGTGTATAATGG - Intergenic
976337555 4:83908207-83908229 AAGTCACTGATTACTTTAAAAGG - Intergenic
976936001 4:90633844-90633866 AAGAAACTGATCTTTAAAAAAGG - Intronic
977144999 4:93428511-93428533 TAGTCACTGGTTATTTAAAAAGG + Intronic
977185984 4:93937009-93937031 AAGAATCTGATTTTTTAAATGGG + Intergenic
978032303 4:103950024-103950046 AAATAACTGGTTGTTTAAAAAGG + Intergenic
979084751 4:116393211-116393233 AAGACACTTTTTTTTCAAAAAGG - Intergenic
979281006 4:118867596-118867618 AATACACTGATTTTTTAAATCGG - Intronic
979564855 4:122143315-122143337 AGGAAACCAATTGTTTAAAATGG - Intergenic
979723610 4:123933513-123933535 AATACACTGATTGCATAACAAGG + Intergenic
980026743 4:127777279-127777301 GACAAACTGATTATTTAAAAAGG + Intergenic
980468961 4:133225400-133225422 CAGACACTGATTTTTAAAATTGG + Intergenic
980471619 4:133260250-133260272 AAATAACTGGTTGTTTAAAAAGG - Intergenic
981424963 4:144592689-144592711 AATTCAGTGGTTGTTTAAAAAGG - Intergenic
981526671 4:145713596-145713618 AAGAAACTGATTCCTTGAAATGG + Intronic
981783026 4:148446189-148446211 AAGGCAGTGATTGTTTTAACAGG - Intergenic
981985852 4:150854958-150854980 CAGCCACTGATCTTTTAAAAAGG - Intronic
982409288 4:155056145-155056167 AATAAACTAGTTGTTTAAAAAGG + Intergenic
983197106 4:164819136-164819158 AAAACACTTCTTGTGTAAAAGGG + Intergenic
983263702 4:165485654-165485676 AATACACTATTTGTTCAAAAAGG - Intronic
983451387 4:167915709-167915731 GTTACACTAATTGTTTAAAATGG + Intergenic
983806111 4:171994470-171994492 AAAACACTTATTGCTTAGAAGGG + Intronic
983857617 4:172664901-172664923 AACAACCTGATTGTGTAAAAGGG + Intronic
983861980 4:172718729-172718751 CAGACCCTGAGTGTTCAAAATGG + Intronic
983921752 4:173353401-173353423 AAGACATCGTTTGTATAAAATGG + Intergenic
984107939 4:175573763-175573785 AAGCCTCTGATCGTGTAAAATGG - Intergenic
984346126 4:178529035-178529057 AAGACACAGAATGTAAAAAATGG - Intergenic
984459947 4:180021647-180021669 AGCACACTGATGGTTTACAAGGG - Intergenic
984613272 4:181865913-181865935 ACTAAACTGATTATTTAAAATGG - Intergenic
985055298 4:186030867-186030889 AATATACTGATTGCTTCAAATGG + Intergenic
985190196 4:187364642-187364664 ATGACACTGACATTTTAAAAGGG - Intergenic
987413771 5:17641419-17641441 AGGCAACTGATTGTTTAAAAAGG - Intergenic
987679248 5:21114157-21114179 AAAATAATGGTTGTTTAAAAAGG - Intergenic
988311901 5:29570004-29570026 AAGACATAGATAGTTTGAAAAGG + Intergenic
988923741 5:35968139-35968161 AAAACACCAATTGGTTAAAAAGG + Intronic
989452588 5:41604393-41604415 AAGAATCTGATTATCTAAAACGG - Intergenic
990066562 5:51722817-51722839 AAAACTCTGATTTTTAAAAATGG - Intergenic
990133542 5:52617602-52617624 AAATCAAGGATTGTTTAAAAGGG - Intergenic
990219264 5:53569416-53569438 AAGACACTGAACATCTAAAAAGG - Intronic
991147950 5:63329333-63329355 ATGACACTGGTGGTTTAATAAGG + Intergenic
991152943 5:63393264-63393286 GAGACACTGACTCTTTAAAGTGG - Intergenic
992263520 5:74994235-74994257 AGTACTCTGATTTTTTAAAAAGG + Intergenic
992317638 5:75574346-75574368 AAGAGACTGATAATTGAAAAGGG + Intronic
992434525 5:76742569-76742591 AAGACACTGGGGGTTTAAAGTGG + Intergenic
993048689 5:82899010-82899032 AAGACACGGATATTTAAAAAAGG - Intergenic
993494932 5:88597591-88597613 AACACACTTCTTCTTTAAAAAGG - Intergenic
994004787 5:94824995-94825017 GATACACTGATTGTTTTGAAGGG + Intronic
994653874 5:102564469-102564491 AAGACACACATAGATTAAAAGGG + Intergenic
995306757 5:110660540-110660562 GAAACACTGATTACTTAAAATGG + Intronic
996955108 5:129174170-129174192 AAGGCACTGAATGTTAAACACGG + Intergenic
997302693 5:132818027-132818049 AAGACACTAAATGAGTAAAAAGG - Intergenic
998083761 5:139299159-139299181 AATACATTGAATGATTAAAAGGG + Intronic
998246077 5:140506468-140506490 AAGAAACAGATTTTTTAAAAGGG - Intronic
998472592 5:142394592-142394614 AAGAAAAAGCTTGTTTAAAAAGG - Intergenic
998652545 5:144137235-144137257 AAGATACTGAAAGTTCAAAATGG - Intergenic
998658000 5:144204342-144204364 AAGACACTGGTGTTTTAAAGGGG + Intronic
999114377 5:149149681-149149703 TAGCCACTGATTGTTTTATAAGG + Intronic
999550463 5:152680862-152680884 AAGAAACTGATCATTTAAAGGGG + Intergenic
1000948552 5:167451947-167451969 CAGCAACTGATTTTTTAAAAAGG + Intronic
1001335554 5:170793654-170793676 AAGGAACTAATTGTTTAGAAAGG - Intronic
1001584167 5:172821560-172821582 CAGACACTGATTGTCCAAAGGGG + Intergenic
1001743330 5:174071202-174071224 GAGCCACTGGTTGTTTAAAAAGG - Intronic
1004661356 6:17712742-17712764 AAGTCACTGTTTGTTTAAACTGG - Intergenic
1006663198 6:35667074-35667096 AATAAACTGATTTTTTTAAAAGG - Intronic
1008114860 6:47537300-47537322 AACACACTCATTTTTTCAAAAGG - Intronic
1008642289 6:53476381-53476403 AAGACACTGCTTGATAAAAGTGG + Intergenic
1008770382 6:54971569-54971591 AAGACACTGAGAGATTATAAGGG + Intergenic
1009944198 6:70323946-70323968 AAGCTACTGATTGTTGAAACTGG + Intergenic
1010106876 6:72180556-72180578 AAGCCACTGAATATTTAAACAGG + Intronic
1010398352 6:75418772-75418794 TTAACACTGATTTTTTAAAAAGG - Intronic
1010908234 6:81519931-81519953 GAGAGACTGATTCTTTAACAGGG - Intronic
1011262618 6:85484817-85484839 AAAATAGGGATTGTTTAAAATGG + Intronic
1012259926 6:97076247-97076269 AAAACACTGAATGTCTAATATGG - Intronic
1012945092 6:105456936-105456958 AAGAAACTGATTACTTAAAGAGG + Intergenic
1013261418 6:108447168-108447190 GAGCCACTACTTGTTTAAAAAGG + Intronic
1014133101 6:117857208-117857230 AAATAACTGGTTGTTTAAAAAGG - Intergenic
1014817428 6:125951281-125951303 AGGAGACTGAGTGTTTAGAAGGG - Intergenic
1015485019 6:133759981-133760003 GGGTCACAGATTGTTTAAAAAGG - Intergenic
1015486413 6:133775052-133775074 TAGACATTGATTGTTTAAAATGG + Intergenic
1017847270 6:158269988-158270010 AAAACACTGAGTTTTTGAAAAGG + Intronic
1019822326 7:3254303-3254325 AAGAAAGTGATTTCTTAAAATGG + Intergenic
1020340734 7:7107629-7107651 AAATGACTGGTTGTTTAAAAAGG + Intergenic
1020521850 7:9199868-9199890 AAGAGACTGATATTTTTAAAGGG + Intergenic
1020602202 7:10290305-10290327 CTGATACTGATTGATTAAAAGGG - Intergenic
1021678235 7:23103039-23103061 AAGAAAGTGGTTGTTTGAAAAGG + Intergenic
1022916889 7:34965764-34965786 AAGACAATGTTTGTTTTTAAAGG + Intronic
1023735204 7:43229772-43229794 AAGATACTCATTATTTACAAAGG + Intronic
1026080931 7:67219983-67220005 TAAACACTGATTTTTAAAAAAGG - Intronic
1027976225 7:85159338-85159360 AAGTCAATGACTGTTAAAAAGGG - Intronic
1028740073 7:94264236-94264258 ATGACGCTGTTTGCTTAAAATGG + Intergenic
1029293961 7:99524556-99524578 AAAACACTGATGTTTTAATATGG - Intronic
1030437681 7:109545363-109545385 ATGACACGCATTGCTTAAAATGG + Intergenic
1031264169 7:119563511-119563533 AAGACAATTAATGTTTTAAAGGG - Intergenic
1031273375 7:119684687-119684709 AAGCCAATGATTGATTACAATGG + Intergenic
1031363655 7:120877314-120877336 AAGCCAATGATAGTTTTAAATGG - Intergenic
1036506082 8:9357648-9357670 AAGAGACAGATTGCTTACAAAGG - Intergenic
1037072149 8:14664168-14664190 AAGACACTCATCTTTTAAATAGG + Intronic
1037868704 8:22470572-22470594 AAGATACTAAATGTTTTAAATGG + Intronic
1037961189 8:23099455-23099477 GAAACATTGATTGTCTAAAATGG - Intronic
1037970488 8:23168402-23168424 GAAACATTGATTGTCTAAAATGG + Intergenic
1038037134 8:23696106-23696128 AAACAACTGATTGTTTAAAAAGG + Intergenic
1039100023 8:33930923-33930945 AAGACTCTGATCTCTTAAAATGG - Intergenic
1039231285 8:35451443-35451465 AAGACATTGAGTCTTTACAATGG + Intronic
1040991109 8:53350959-53350981 AAATAACTGGTTGTTTAAAATGG - Intergenic
1040996450 8:53407558-53407580 TGGGCGCTGATTGTTTAAAAGGG + Intergenic
1041646269 8:60255606-60255628 AAGACATTAATTGATGAAAAAGG + Intronic
1042824456 8:72966012-72966034 AAAACAGTGACTGTTTAATAGGG + Intergenic
1042829445 8:73010245-73010267 AAGGTACTGATAGGTTAAAAGGG + Intronic
1043040394 8:75255048-75255070 AAGCAACTGATTTTTTACAAAGG + Intergenic
1044198425 8:89405489-89405511 AAGAGACTAATGGTCTAAAATGG + Intergenic
1044861491 8:96527727-96527749 AAGGCACTGAATGTTTGGAATGG + Intronic
1045622723 8:104000888-104000910 AATAATCTGATTTTTTAAAATGG - Intronic
1045909333 8:107387910-107387932 AAGACACTGAAAATTTAGAAAGG - Intronic
1046296895 8:112231379-112231401 AAGAATGTGATTATTTAAAAGGG + Intronic
1046906333 8:119577372-119577394 CAGACACTGAATATTTTAAATGG + Intronic
1046909472 8:119610186-119610208 AAGACACTGCTTTTTAAAATTGG - Intronic
1047077173 8:121417285-121417307 AAAACAGTGATATTTTAAAATGG + Intergenic
1047838556 8:128721040-128721062 AAGACATTTTTTGTTCAAAATGG - Intergenic
1049944935 9:585115-585137 AAGACACTGAGTGGTTACAGAGG - Intronic
1050526209 9:6549007-6549029 CAGACGCTGGGTGTTTAAAATGG - Intronic
1051146983 9:14037225-14037247 AAGCCTCGGATGGTTTAAAAGGG - Intergenic
1051947165 9:22582778-22582800 AAGACAATTATCTTTTAAAAAGG - Intergenic
1053124999 9:35574001-35574023 AATAAAGTGATTTTTTAAAAAGG + Intergenic
1055192793 9:73546885-73546907 CATACACTCTTTGTTTAAAAGGG - Intergenic
1056368659 9:85932305-85932327 AAGACACACATTTTTTAAAAAGG + Intergenic
1056674874 9:88666830-88666852 AAGCCATTAATTGTTTATAAAGG - Intergenic
1056814481 9:89791661-89791683 AAAACACAGAATGTTTAAGAGGG + Intergenic
1057281947 9:93719686-93719708 TAGACAGTATTTGTTTAAAATGG - Intergenic
1057416714 9:94870291-94870313 AAGACATTAATTATTTTAAAAGG + Intronic
1058557078 9:106180995-106181017 AAGACAATGGTTGCCTAAAAGGG - Intergenic
1058815775 9:108681569-108681591 ATGCAACTGATTCTTTAAAATGG + Intergenic
1058918812 9:109593758-109593780 GAGGAACTGATTGTTAAAAAGGG - Intergenic
1059577907 9:115511360-115511382 ATGATACTGATTGTTGTAAAAGG + Intergenic
1060000554 9:119954485-119954507 AAAACACTGATTGTTGAAGAAGG - Intergenic
1060460732 9:123852074-123852096 AAGACACTGATTGTTTAAAAGGG - Intronic
1061767608 9:132891599-132891621 AAGAAACTGATTTTTTTTAACGG - Exonic
1062223858 9:135437680-135437702 AAAACAGTCTTTGTTTAAAAGGG - Intergenic
1062304021 9:135891999-135892021 AAGAAACTGATGGGATAAAATGG + Intronic
1186497040 X:10019597-10019619 AAGACAGTGAATCTTTACAAAGG - Intronic
1186958505 X:14709221-14709243 AAGACCCTGTCTCTTTAAAAAGG + Intronic
1188532360 X:31156216-31156238 AAGGCTCTGAATGTTTTAAAGGG - Intronic
1188586948 X:31788359-31788381 GATTTACTGATTGTTTAAAAAGG - Intronic
1188911246 X:35850421-35850443 CAGACATTGATTATTTATAATGG + Intergenic
1189707701 X:43775933-43775955 AAAACAATGTTTGTTTTAAAGGG + Intronic
1190534818 X:51415843-51415865 ATGCCACTCATTGATTAAAACGG - Intergenic
1191021942 X:55869987-55870009 AAAACACTGATTGTTTTATGAGG - Intergenic
1191636769 X:63386564-63386586 AACAAACTATTTGTTTAAAAGGG - Intergenic
1193105729 X:77669624-77669646 AATACACTTATTTTTAAAAATGG - Intronic
1194541080 X:95173144-95173166 AAGATACTCATGGTTTACAACGG + Intergenic
1194980026 X:100431034-100431056 AAGTCCCTGTTTGTTTAAAAAGG - Intergenic
1195173829 X:102295790-102295812 TAGACACTGAAAGTTCAAAAAGG - Intergenic
1195185036 X:102391303-102391325 TAGACACTGAAAGTTCAAAAAGG + Intronic
1195729590 X:107952707-107952729 TAAACACAGATTTTTTAAAATGG - Intergenic
1196686158 X:118512286-118512308 AAGAAACTGAAGGATTAAAAAGG + Intronic
1197106741 X:122725651-122725673 AAAACACACATTATTTAAAAAGG - Intergenic
1197171425 X:123438878-123438900 AAGACTGAGATTGTTTAAACAGG - Intronic
1197174869 X:123474801-123474823 ATAACATTGATTCTTTAAAATGG + Intronic
1197300185 X:124770197-124770219 AAGAAACAAATTGTTTAAAGAGG + Intronic
1198887336 X:141353933-141353955 ACCAAACTGATGGTTTAAAATGG + Intergenic
1199173057 X:144754271-144754293 AATTCGCTGATTTTTTAAAAGGG + Intergenic
1199353788 X:146836286-146836308 AGGAGAGTGAGTGTTTAAAATGG + Intergenic
1199378012 X:147135024-147135046 AAATAACTGGTTGTTTAAAAAGG + Intergenic
1199526208 X:148794660-148794682 AAAATACTGATAGTCTAAAAAGG - Intronic
1199749032 X:150797466-150797488 AAGACACTAAATTGTTAAAATGG + Intronic
1200798561 Y:7364003-7364025 AAGAAACTGTCTGATTAAAATGG + Intergenic
1202085784 Y:21135336-21135358 AAAACACTGATTGTCTAAAATGG - Intergenic
1202173242 Y:22073371-22073393 AAGAGACTTATTGTTTCCAAAGG - Intronic
1202218118 Y:22513003-22513025 AAGAGACTTATTGTTTCCAAAGG + Intronic
1202325067 Y:23683055-23683077 AAGAGACTTATTGTTTCCAAAGG - Intergenic
1202545704 Y:25986999-25987021 AAGAGACTTATTGTTTCCAAAGG + Intergenic