ID: 1060460733

View in Genome Browser
Species Human (GRCh38)
Location 9:123852075-123852097
Sequence GAAGACACTGATTGTTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 305}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060460733_1060460738 17 Left 1060460733 9:123852075-123852097 CCTTTTAAACAATCAGTGTCTTC 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1060460738 9:123852115-123852137 TGTCCCGCCATTACACTCTGGGG No data
1060460733_1060460736 15 Left 1060460733 9:123852075-123852097 CCTTTTAAACAATCAGTGTCTTC 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1060460736 9:123852113-123852135 CCTGTCCCGCCATTACACTCTGG No data
1060460733_1060460743 28 Left 1060460733 9:123852075-123852097 CCTTTTAAACAATCAGTGTCTTC 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1060460743 9:123852126-123852148 TACACTCTGGGGAAGAGTGGTGG No data
1060460733_1060460742 25 Left 1060460733 9:123852075-123852097 CCTTTTAAACAATCAGTGTCTTC 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1060460742 9:123852123-123852145 CATTACACTCTGGGGAAGAGTGG No data
1060460733_1060460737 16 Left 1060460733 9:123852075-123852097 CCTTTTAAACAATCAGTGTCTTC 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1060460737 9:123852114-123852136 CTGTCCCGCCATTACACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060460733 Original CRISPR GAAGACACTGATTGTTTAAA AGG (reversed) Intronic
901251997 1:7785869-7785891 GAAGACAATATTTCTTTAAAAGG - Intronic
901294641 1:8151495-8151517 GAAGGTACTGATTTTTTAAATGG - Intergenic
903486449 1:23692479-23692501 GAAGACCCTGAATGTTTAAAAGG - Intronic
904979261 1:34483329-34483351 AAATACACTGATATTTTAAATGG - Intergenic
905111582 1:35598651-35598673 GTATACACAGATTGTTTACATGG + Intergenic
905290175 1:36916283-36916305 AAAGGCACTGATTTTTAAAAAGG + Intronic
905948967 1:41929224-41929246 GAATACACTGATTATTTGATGGG - Intronic
907577167 1:55537315-55537337 GAAGACCTACATTGTTTAAATGG + Intergenic
908232465 1:62119352-62119374 CAAGATCCTGATTTTTTAAATGG - Intronic
908707439 1:66974752-66974774 GAGGACAGTAATTCTTTAAAAGG + Intronic
909228220 1:73052929-73052951 AAACAAACTGATTTTTTAAATGG + Intergenic
909843600 1:80361345-80361367 GAAGATACAGAATGTTTTAAGGG + Intergenic
910125234 1:83833534-83833556 TAAGAGACTGATTTTTCAAAAGG - Intergenic
910202099 1:84710298-84710320 GAAGACATTGATTGTTTCAGTGG + Intergenic
911403319 1:97404728-97404750 AAAGACAAAGATTGTTTAAGTGG - Intronic
911737178 1:101350491-101350513 GAAGAAACAGAAAGTTTAAAAGG + Intergenic
912476664 1:109941907-109941929 GAAGAGACTGGTTGATTGAATGG - Intergenic
915529114 1:156493344-156493366 GAAGCCACTGAGGATTTAAAGGG + Intronic
916196204 1:162225599-162225621 GACAACACTGATTGTTTATGAGG - Intronic
917257915 1:173135509-173135531 GAAGAGACTGATTATTTACAAGG - Intergenic
917820538 1:178758899-178758921 TAATACTCTGATTTTTTAAATGG - Intronic
918496102 1:185138626-185138648 GAAAACAGTTATTTTTTAAAAGG - Intronic
919005493 1:191894011-191894033 GAAGACACTAAACGTTAAAAAGG + Intergenic
919508410 1:198429448-198429470 GAAGAGACTGATGGTTTAGAAGG - Intergenic
919679599 1:200421214-200421236 GAAGACAGTGAGTTTTCAAAGGG + Intergenic
919837538 1:201585623-201585645 AAAAAAACTGATTTTTTAAATGG + Intergenic
921659719 1:217787149-217787171 TAAGACAGTGATAGTATAAAGGG - Intronic
921732403 1:218593103-218593125 GAGAAAGCTGATTGTTTAAAAGG - Intergenic
922969666 1:229725531-229725553 GAAGACAGAGATGGTTAAAATGG - Intergenic
923365935 1:233261400-233261422 GCAGTCACTGATTTTCTAAATGG + Intronic
924052981 1:240095736-240095758 GAAGACACTTGTTTTTTTAAAGG - Intronic
1064407100 10:15073829-15073851 GAAGTAAATGATTGTTTCAATGG + Exonic
1066042925 10:31569246-31569268 GAAGACAGAGATTGTCTGAATGG + Intergenic
1066399183 10:35058179-35058201 GAAGATGCTGATTCTATAAAGGG + Intronic
1066593891 10:37027313-37027335 GGAGACATTGATAGTTTAAACGG + Intergenic
1067813652 10:49452926-49452948 AAAGACACAGATAGATTAAAAGG - Intergenic
1069082084 10:64099399-64099421 GGAGACACAGATCATTTAAATGG + Intergenic
1069821430 10:71230882-71230904 GAACACACAGGTTGTTTATATGG + Intronic
1070460591 10:76665576-76665598 GATGACTCTAATTGTTTATATGG - Intergenic
1071918957 10:90327981-90328003 AAATACACAGATTGTTAAAAAGG + Intergenic
1073929422 10:108556647-108556669 GAAGACACATATAGATTAAAAGG + Intergenic
1074039346 10:109772674-109772696 CAATACACTGATAGATTAAATGG + Intergenic
1074185953 10:111099597-111099619 GAAGAAACTGAGTGGTTAACCGG + Intergenic
1075222540 10:120597687-120597709 GAGGACACTGAATCTTTGAAAGG - Intergenic
1076151766 10:128168281-128168303 GAATACACTGAATGAATAAAAGG - Intergenic
1076160402 10:128239908-128239930 GAAGACACTGCTTGTTCCACTGG + Intergenic
1078307935 11:10209731-10209753 GGAGACACTGAATGCTTAGATGG - Intronic
1079852723 11:25557686-25557708 GAAGACAAACATTTTTTAAATGG - Intergenic
1079874404 11:25838745-25838767 GAAGACACTAATTTCTGAAATGG - Intergenic
1080483684 11:32680721-32680743 TAACAAACTGATTGTTTTAAGGG - Intronic
1080708099 11:34718472-34718494 TAGGAAACTGATTTTTTAAAAGG + Intergenic
1081375522 11:42353523-42353545 GAGGACACTGATTGTTGAGGAGG + Intergenic
1081927078 11:46839795-46839817 GAGGAAACTGAGTCTTTAAAAGG - Intronic
1085894417 11:80621003-80621025 GGAGACACTGATAGTTTAAATGG - Intergenic
1086906129 11:92419901-92419923 GAAGACACTAAGAGGTTAAAAGG - Intronic
1086943500 11:92822101-92822123 GAAGAAACTGGATGTTTAAAAGG - Intronic
1087936635 11:104041587-104041609 GAAGCCAAGGATTTTTTAAATGG - Intronic
1087947578 11:104182550-104182572 GAAGAAACTGATACTTTAAGAGG + Intergenic
1089847012 11:121466411-121466433 GAAGCCACTGATTAAGTAAAGGG + Intronic
1090210832 11:124920210-124920232 GAGGACAATGATTGTTTGAAAGG + Exonic
1090586818 11:128222146-128222168 GAAATCATTCATTGTTTAAAAGG - Intergenic
1092008603 12:5089635-5089657 GATGATCCTGTTTGTTTAAATGG - Intergenic
1092835128 12:12480411-12480433 GAAGACACTGAGTAAGTAAATGG - Intronic
1093859943 12:24152971-24152993 GAAGACTCTGATGAGTTAAATGG + Intergenic
1094383618 12:29869884-29869906 GAAGACAATGAAATTTTAAAAGG + Intergenic
1094572862 12:31657041-31657063 GAAGAAACTGATTATTAAGAAGG + Intronic
1094660843 12:32469171-32469193 GTATATACTTATTGTTTAAATGG + Intronic
1098019538 12:66138553-66138575 CAAGACCCTGATTTTCTAAAGGG + Intronic
1099388113 12:82043417-82043439 GATGACAATAATTATTTAAATGG - Intergenic
1099726340 12:86432638-86432660 GAAGATACAGATTATTTAATGGG - Intronic
1100749710 12:97684646-97684668 AAAGATACAGATAGTTTAAAAGG + Intergenic
1101283376 12:103283280-103283302 CAAGACAGTGATTGTAGAAATGG - Intronic
1101702521 12:107188241-107188263 GAATTCACTGATTTTTTGAAGGG - Intergenic
1101896603 12:108761790-108761812 AAAGACACAGTTTGGTTAAAGGG - Intergenic
1103285426 12:119797140-119797162 GAAGACAGTCATTGACTAAATGG - Intronic
1105488841 13:20866658-20866680 TGAGACACTGACTATTTAAAAGG - Intronic
1105538128 13:21288875-21288897 GAAGACACTAATTTTTAAGATGG - Intergenic
1106355621 13:28980132-28980154 GAATACATTCATTGTTTAAAAGG + Intronic
1106741864 13:32652948-32652970 AAAGATACTGAATGTTTATAAGG + Intronic
1107088798 13:36453683-36453705 GAGGACACTGTGTGGTTAAAAGG - Intergenic
1107289529 13:38836902-38836924 GGATACATTGATTTTTTAAAGGG + Intronic
1108489136 13:50962636-50962658 GAAGACAATGATTCTTTGAAAGG - Intronic
1108812725 13:54248745-54248767 GAAGACTCTCATTTTTTAAATGG - Intergenic
1109083287 13:57935503-57935525 GAAGATACTGATTGTTTGTATGG - Intergenic
1109152949 13:58867379-58867401 AAAGACATAGATTGGTTAAATGG + Intergenic
1109607091 13:64710318-64710340 AAAGACACTGTATGTTTCAAAGG + Intergenic
1109771696 13:66982705-66982727 GGAGTCACTGTTTGTTTACAAGG - Intronic
1110191381 13:72733176-72733198 AAAGACACTGCTTGTTTCTAAGG - Intronic
1111440214 13:88272652-88272674 GGAGAAACTGATTGTTCAAGAGG + Intergenic
1111643071 13:90995755-90995777 GAAAACACTGATTTCTTCAAGGG - Intergenic
1114056548 14:18973435-18973457 GAAAACACTGAATTTGTAAAAGG + Intronic
1114106001 14:19428292-19428314 GAAAACACTGAATTTGTAAAAGG - Intronic
1114807848 14:25858030-25858052 GAAGAAAATGTTTGTTTATATGG + Intergenic
1115442302 14:33449654-33449676 GAAGAAACTGAGAATTTAAATGG + Intronic
1115924778 14:38419607-38419629 GGACATACTGAATGTTTAAAAGG + Intergenic
1116727959 14:48586601-48586623 AATGACACCGATTCTTTAAAAGG - Intergenic
1117766279 14:59086743-59086765 GAGGACATTCATTTTTTAAATGG - Intergenic
1117799902 14:59432755-59432777 GAAGACACTGATTTTCAAAAAGG + Intronic
1120320138 14:82949255-82949277 GAAGCCATTGATTGCTGAAAAGG + Intergenic
1120956110 14:90083692-90083714 CAAGACACTGACAGTTTGAAAGG - Intronic
1121418726 14:93797519-93797541 GGAGACACGGATGGTTTTAAAGG - Intergenic
1121809948 14:96876355-96876377 CGAGACACTGAATGATTAAATGG + Intronic
1122760146 14:104018252-104018274 CCAGACGCTGATTGTTAAAACGG + Intronic
1122762312 14:104038329-104038351 GAAGACTCTCACTGTTTAACTGG + Intronic
1124084494 15:26534535-26534557 GGATTCACTGATTTTTTAAAGGG - Intergenic
1124830375 15:33143092-33143114 AAAGAAACTGATCTTTTAAATGG - Intronic
1126684535 15:51236110-51236132 GAGGACACTATTTTTTTAAATGG + Intronic
1129242030 15:74257539-74257561 GAAGACACTGATTGTGGCCACGG + Intronic
1129584960 15:76853128-76853150 GAACAAACTGATTCTCTAAATGG + Intronic
1130750631 15:86708658-86708680 GAAGACACTGATGTTCTAAGAGG + Intronic
1131439468 15:92448126-92448148 GAACAGCCTGTTTGTTTAAAGGG - Intronic
1133586344 16:7199305-7199327 GGATCCACTGAGTGTTTAAAGGG + Intronic
1134221419 16:12357675-12357697 GCAGGCACTGACTGTTTAAAGGG - Intronic
1134472067 16:14533846-14533868 CAAGACACTGATTCCTTGAATGG + Intronic
1135684716 16:24489595-24489617 GCAGAAGCTGGTTGTTTAAAGGG + Intergenic
1137543776 16:49383576-49383598 TAAGACACTGGTTGTGGAAATGG - Intronic
1138480508 16:57299743-57299765 GAATACACAGATAATTTAAATGG - Intergenic
1138818541 16:60230525-60230547 GAAGAAACTCACTGATTAAATGG + Intergenic
1139005413 16:62564717-62564739 AAAGACATTGATTATTTCAATGG + Intergenic
1139499033 16:67345579-67345601 GAACTGACTGATTGATTAAATGG + Intronic
1139864922 16:70053833-70053855 GAAGAAACTGACTCTTTACAGGG + Intergenic
1140993180 16:80233897-80233919 GAACACACTGTTTGAATAAATGG - Intergenic
1147876877 17:43628012-43628034 GAAGCCAATGTTTGGTTAAATGG - Intergenic
1156073806 18:33247330-33247352 GAAATCACTGATTTTGTAAAAGG + Intronic
1158621594 18:59037267-59037289 GAATACAATCAATGTTTAAAAGG - Intergenic
1160047031 18:75395924-75395946 AAAAACACAGATTTTTTAAAAGG - Intergenic
1163956614 19:20648343-20648365 GAAGAAAATGCTTATTTAAATGG - Intronic
1164439939 19:28268484-28268506 GAAGACACAAATTGGATAAAAGG - Intergenic
1164993489 19:32701827-32701849 AAAGACACAGATAGTTTAAAAGG - Intronic
927042213 2:19241006-19241028 GAAGACACTGATGATTCAAGAGG + Intergenic
927168488 2:20349457-20349479 GAAGTAAATCATTGTTTAAAAGG + Intronic
927343394 2:22008630-22008652 AAAGAAACTGATTTTTCAAAAGG - Intergenic
929625959 2:43406995-43407017 GCAGCCACTGACTCTTTAAAGGG + Intronic
929908643 2:46069507-46069529 CAGGAAACTGATTTTTTAAATGG - Intronic
931463608 2:62468448-62468470 GAAGTCACTGATATTTTAAGGGG - Intergenic
932636371 2:73391879-73391901 GAATACAGAGATAGTTTAAATGG - Intronic
934055797 2:88250448-88250470 GAAGACTCTGAGTGGTTAAGGGG - Intergenic
934095116 2:88594673-88594695 GAAGAAACTGAGACTTTAAAAGG - Intronic
935171793 2:100615904-100615926 GAAGACACTGCTTTTTGAAACGG + Intergenic
935931332 2:108129612-108129634 GAAGAGACTAATTGTTTAATGGG - Intergenic
938474668 2:131597450-131597472 GAAAACACTGAATTTGTAAAAGG + Intergenic
938557966 2:132442942-132442964 GAATACTCTTATTTTTTAAATGG + Intronic
938584472 2:132675713-132675735 GATGACAGTGAGTGTTTTAATGG - Intronic
938598804 2:132816437-132816459 GAAGCCCCTGCTTGTTTCAATGG + Intronic
938673958 2:133611782-133611804 GAAAACAATGATTATTTGAAGGG - Intergenic
940321912 2:152386352-152386374 AGAGACCCTGATTTTTTAAAGGG + Intronic
941819515 2:169830029-169830051 GACGACACTGATTTTTTAATAGG - Intronic
941897433 2:170643604-170643626 GAACACTCTGTTTGCTTAAAGGG + Intronic
942782247 2:179658112-179658134 GAAGATACATATTTTTTAAAAGG - Intronic
943006000 2:182387882-182387904 AAAGACACTGAATGGTTGAATGG + Intronic
944160203 2:196651971-196651993 GTTCACACTGGTTGTTTAAAGGG - Intronic
946263458 2:218517198-218517220 GAAGACACAGAATAATTAAATGG - Intronic
946600783 2:221357660-221357682 GAAGAAACTGAATGATTACATGG - Intergenic
947904081 2:233747043-233747065 AAAGACAATGATTGGTTAATCGG + Intronic
948015895 2:234690337-234690359 GAAGCTTCTGATTGTTTGAAAGG - Intergenic
1168999218 20:2154943-2154965 GAAGGCTCTGATTCTTTCAATGG + Intronic
1171082121 20:22197299-22197321 GGATACACTGATTTTTTGAAGGG - Intergenic
1171096694 20:22339085-22339107 GAATAATCTGATTTTTTAAATGG + Intergenic
1173109163 20:40169489-40169511 AAAGACACAGATTGTTAAGAGGG - Intergenic
1175020395 20:55841650-55841672 AAAAAAACTGATTTTTTAAATGG + Intergenic
1175089596 20:56491022-56491044 GAAAACACAGCTTGTTAAAAAGG - Intronic
1175562867 20:59946332-59946354 AAATACAGTAATTGTTTAAAGGG - Exonic
1176350266 21:5788307-5788329 GAATTCACTGATTTTTTGAAGGG - Intergenic
1176357080 21:5908891-5908913 GAATTCACTGATTTTTTGAAGGG - Intergenic
1176544587 21:8186377-8186399 GAATTCACTGATTTTTTGAAGGG - Intergenic
1176563538 21:8369422-8369444 GAATTCACTGATTTTTTGAAGGG - Intergenic
1176963790 21:15189302-15189324 GAAGTAGATGATTGTTTAAAAGG + Intergenic
1177732048 21:25040081-25040103 AAAGAGACTAATTGTTTGAAAGG + Intergenic
1179080974 21:38170443-38170465 GCAGGCACTGATTGTTTCTAAGG + Intronic
1179315933 21:40244502-40244524 TAAGAAAATGATTGATTAAATGG - Intronic
1180475034 22:15696048-15696070 GAAAACACTGAATTTGTAAAAGG + Intronic
1182385537 22:29937222-29937244 GAGGATACTGACTCTTTAAATGG + Intronic
1184755426 22:46513062-46513084 GAAGTCACTCACTGGTTAAATGG - Intronic
1185090402 22:48765520-48765542 CAAGATAGTGATTGTTTCAAGGG - Intronic
1185246149 22:49774406-49774428 GAAGCCACTGCCTTTTTAAAAGG + Exonic
1185360306 22:50402849-50402871 GAAGACACTGATTCTCTAGATGG - Intronic
1203249456 22_KI270733v1_random:102614-102636 GAATTCACTGATTTTTTGAAGGG - Intergenic
950825553 3:15815931-15815953 GAAGACATTAACTTTTTAAATGG - Intronic
951455150 3:22883500-22883522 GATGACACTTATTATTGAAATGG + Intergenic
952284119 3:31951776-31951798 GAAGAAACTGAGAGTTAAAAAGG + Intronic
954757418 3:52848986-52849008 CAAGGCACTGACAGTTTAAAAGG - Intronic
955375840 3:58396501-58396523 TAAGCCACTGATTATTTATATGG + Intronic
955526990 3:59831420-59831442 GAAGACACTGAGTCTTAGAAAGG + Intronic
956830405 3:73041507-73041529 AAATACACTTAATGTTTAAAAGG - Intronic
956953884 3:74314429-74314451 GAAGACACACATAGATTAAAAGG + Intronic
958073719 3:88649114-88649136 AAAGACACTGATTTTTCCAATGG - Intergenic
958123641 3:89326878-89326900 CATGAGACTGATTATTTAAAGGG + Intronic
958587757 3:96113090-96113112 GAAAAAACTGATTGAATAAAAGG - Intergenic
960362322 3:116728510-116728532 GAAGATGCTGTTTGTTTTAAAGG - Intronic
963224218 3:142844990-142845012 GAAGACAGTTATTGTTAGAATGG - Intronic
963619615 3:147589426-147589448 GAAGAGACTGATTATGTGAAGGG + Intergenic
963882926 3:150548178-150548200 GAAGAAACAGGTTGTTCAAAGGG - Intronic
966136320 3:176702976-176702998 AAAGTCACTTATTGTTGAAATGG + Intergenic
966357124 3:179092670-179092692 CAAGACACTGATTAATTATAAGG - Intergenic
966764937 3:183452472-183452494 TAAAACACTGATTCTTTCAAGGG - Intergenic
967112050 3:186302427-186302449 GAAGACACAGATTGGAAAAAGGG + Intronic
967388656 3:188933893-188933915 GGAGACACTGATTTTTAGAAAGG - Intergenic
967432794 3:189406658-189406680 CCAGACTCTGATTCTTTAAAAGG - Intergenic
967691613 3:192480426-192480448 GAAGTCACTCATTGTAGAAATGG + Intronic
968700224 4:2052739-2052761 CAAGAGACTGATAGTCTAAAGGG + Intergenic
969191475 4:5524482-5524504 GAAGACCCTCATTGTTAACAGGG + Intergenic
972279671 4:37590161-37590183 GACGACACTGATAAATTAAAAGG + Exonic
972356584 4:38284923-38284945 GAATAGACTGAATGGTTAAATGG - Intergenic
972516136 4:39812245-39812267 GAACAATCTGACTGTTTAAAGGG + Intergenic
973720153 4:53715661-53715683 GAAGAAACTGATGGTCTAGAAGG + Intronic
974280230 4:59782482-59782504 GAATTCACTGATTTTTTGAAGGG - Intergenic
974912955 4:68145860-68145882 GAATTCACTGATTTTTTAAAGGG + Intergenic
975039097 4:69723056-69723078 GAATTCACTGATTTTTTGAAGGG - Exonic
975262834 4:72324360-72324382 CAAGACCCTGATTTTTTTAAAGG - Intronic
975282262 4:72574647-72574669 GAATACACTGATTAATTTAATGG - Intergenic
976410169 4:84704254-84704276 GAAGATAATGATGTTTTAAAAGG + Intronic
976508177 4:85874019-85874041 TAAGATACAGATTTTTTAAAAGG - Intronic
976989174 4:91343022-91343044 GAAGATACTGATTTTTGAAGTGG + Intronic
977015497 4:91687807-91687829 AAAGACATTGATAGTTTAACAGG + Intergenic
977076444 4:92457240-92457262 GAAGACAGTGATTTTTCATATGG - Intronic
977185983 4:93937008-93937030 TAAGAATCTGATTTTTTAAATGG + Intergenic
977756402 4:100676847-100676869 GAAGAAACTTGTTATTTAAAGGG - Intronic
978781396 4:112558710-112558732 GAAGACATTAATTAATTAAATGG - Intronic
979089080 4:116454885-116454907 GAAGAGACTGAATTTCTAAATGG - Intergenic
979200656 4:117974113-117974135 CAAGGAACTGATTGTATAAAAGG - Intergenic
979535926 4:121820470-121820492 GAAGAAATTGATTTTTTTAATGG - Intronic
981296966 4:143143549-143143571 GAATTCACTGATTTTTTGAAGGG - Intergenic
981838802 4:149086846-149086868 TATTACACTGATTGTTTCAAAGG + Intergenic
982217622 4:153095768-153095790 GAAGCCACTCATTGTTTCATTGG - Intergenic
982377335 4:154707556-154707578 GAAGATACTATTTGTTTAAGTGG + Intronic
983383703 4:167029663-167029685 GAAAAGACTGATTATCTAAAAGG - Intronic
983517430 4:168672841-168672863 GAAGAAACTGAAGTTTTAAAAGG + Intronic
983539454 4:168893253-168893275 GAATTCACTGATTTTTTAATAGG + Intronic
984894152 4:184521329-184521351 GAAGATACTCTTTATTTAAAGGG - Intergenic
985985907 5:3516107-3516129 GAACACACTGATTATATAATTGG - Intergenic
987347712 5:16993262-16993284 GAAGACCCAGATTGTCTGAATGG + Intergenic
987555750 5:19445367-19445389 ATATACACTGATTATTTAAATGG - Intergenic
988196796 5:28014697-28014719 GAAATGACTGGTTGTTTAAATGG + Intergenic
988964198 5:36400286-36400308 GAAGACATTGTTGGTTGAAATGG + Intergenic
989538319 5:42589196-42589218 GGAGATACTGAATGTTTAACAGG - Intronic
990133543 5:52617603-52617625 GAAATCAAGGATTGTTTAAAAGG - Intergenic
990551406 5:56883575-56883597 GAAGACACTGAATGGCTGAAAGG + Exonic
990733626 5:58836113-58836135 GGATACACTGATTGTCTAACAGG - Intronic
990967969 5:61470236-61470258 GAAGAGACTGATTTTATAAATGG + Intronic
991535333 5:67663776-67663798 GGATTCACTGATTTTTTAAAGGG + Intergenic
992028689 5:72698247-72698269 TAAGAAACTGAATATTTAAATGG - Intergenic
994004786 5:94824994-94825016 GGATACACTGATTGTTTTGAAGG + Intronic
994152930 5:96470216-96470238 GAAAACTCTGAGTTTTTAAATGG + Intergenic
994184633 5:96804503-96804525 GAAGACACTGATGTTATTAAAGG - Intronic
994201496 5:96981706-96981728 GTAGACACTGCTTGTTGTAAGGG + Intronic
994653873 5:102564468-102564490 GAAGACACACATAGATTAAAAGG + Intergenic
994986875 5:106945435-106945457 GGAGTCACTGATCGTTTGAAAGG + Intergenic
995027989 5:107446797-107446819 GAAGACACTGACTTTCTCAAGGG + Intronic
996451260 5:123627789-123627811 GAAGACACAGAATGGCTAAATGG + Intergenic
996533382 5:124549886-124549908 TGAGAAACTTATTGTTTAAATGG - Intergenic
998246078 5:140506469-140506491 CAAGAAACAGATTTTTTAAAAGG - Intronic
998657999 5:144204341-144204363 TAAGACACTGGTGTTTTAAAGGG + Intronic
999550462 5:152680861-152680883 GAAGAAACTGATCATTTAAAGGG + Intergenic
999934503 5:156471925-156471947 AAAGACAGTGATTTTTAAAAGGG + Intronic
1000123744 5:158223592-158223614 GAAGACAGTAAGTGTTAAAATGG - Intergenic
1000185830 5:158857016-158857038 GAAGGAAGTGATTGTTTCAAGGG - Intronic
1000523398 5:162325710-162325732 GAAGAAATTGATTATTTGAAAGG - Intergenic
1001160378 5:169307383-169307405 CAATACACTGATTTTTTAAGGGG + Intergenic
1001481559 5:172092426-172092448 GAAGACACTGAGTGAAAAAAAGG - Intronic
1001584166 5:172821559-172821581 CCAGACACTGATTGTCCAAAGGG + Intergenic
1002462461 5:179381460-179381482 GAAAACAGAGGTTGTTTAAAAGG - Intergenic
1003362054 6:5436432-5436454 AAAGACACTAATTATATAAAAGG - Intronic
1004213240 6:13674288-13674310 AAAGACACAGATAGGTTAAAGGG + Intronic
1004916347 6:20335617-20335639 GAGGGCACTGATTTTTTAAAAGG - Intergenic
1006528918 6:34632992-34633014 GAAAACACAGATTGTTAGAATGG + Intronic
1008010039 6:46456821-46456843 GAAGTCAGTGATTGCTTGAAAGG + Exonic
1009474593 6:64074491-64074513 GAAGATATTCATTGTTTATATGG + Intronic
1010588847 6:77688747-77688769 AATGATACTGATTTTTTAAAAGG - Intergenic
1012050147 6:94331122-94331144 GAAGACACAGACTGTCTGAATGG + Intergenic
1012318519 6:97812730-97812752 GCAGTCTCTGATTGTATAAAGGG + Intergenic
1013560039 6:111294829-111294851 GTAGGAACGGATTGTTTAAAAGG - Intergenic
1014238073 6:118983759-118983781 AAAGACAATCATTTTTTAAATGG - Intronic
1014817429 6:125951282-125951304 GAGGAGACTGAGTGTTTAGAAGG - Intergenic
1015670672 6:135686438-135686460 ACAGACACTGATTGTCTACAAGG + Intergenic
1015907590 6:138133143-138133165 AAAGACACAGAGTGTTTGAATGG - Intergenic
1017243069 6:152193014-152193036 GAAGACATTGAGTGACTAAATGG - Intronic
1017347308 6:153399016-153399038 AAAGAAACTGATGGTTGAAACGG + Intergenic
1018085235 6:160295784-160295806 GAAGACAGTGATTATTTTCATGG + Intergenic
1018511928 6:164533629-164533651 GTAGAAACAGAATGTTTAAAAGG + Intergenic
1020406636 7:7842851-7842873 GAATACAGTTATTGTTAAAAAGG + Intronic
1020515251 7:9109581-9109603 GAAGACATAGAATGTTTGAATGG + Intergenic
1020521849 7:9199867-9199889 GAAGAGACTGATATTTTTAAAGG + Intergenic
1026513048 7:71043414-71043436 GGAGACACTGAGTGATTAAGGGG + Intergenic
1028510435 7:91619663-91619685 GATTAGACTGATTGTTTTAACGG - Intergenic
1030705341 7:112687009-112687031 GAATTCACTGATTTTTTGAAGGG + Intergenic
1030917779 7:115338402-115338424 GTAAACAGTAATTGTTTAAATGG - Intergenic
1030919010 7:115356554-115356576 GAAGACAGTGTTTTTATAAATGG - Intergenic
1031825476 7:126560214-126560236 TAAGTCACTGATTTTTTAACCGG + Intronic
1032145410 7:129375355-129375377 GAAGTCTCTCATTGTTTAAGTGG + Intronic
1036094721 8:5711135-5711157 GAAGGATTTGATTGTTTAAATGG + Intergenic
1038315544 8:26481522-26481544 GAGGACACTGAGTGTGCAAAAGG - Intronic
1038365879 8:26934711-26934733 GAAGACAAGTATTGTTAAAATGG + Intergenic
1040082179 8:43297680-43297702 GAAAACACTGAATTTGTAAAAGG + Intergenic
1040087037 8:43354699-43354721 AAAGACACAAATTGGTTAAAAGG - Intergenic
1043231590 8:77808905-77808927 AAAGACACTGACTCTGTAAATGG - Intergenic
1043923356 8:86009333-86009355 AAAGACACATATTTTTTAAAAGG - Intronic
1045136876 8:99230630-99230652 GAGGAAACTGATTGTTAAAGAGG - Intronic
1046296894 8:112231378-112231400 GAAGAATGTGATTATTTAAAAGG + Intronic
1047477793 8:125251406-125251428 GAAGACAGTGATTTTTAAATGGG + Intronic
1050608485 9:7326413-7326435 GAAGACAAAGATTATGTAAACGG + Intergenic
1051508366 9:17849645-17849667 GAAGACAAGGATTCTTTAAAGGG - Intergenic
1051606412 9:18921954-18921976 CAAGTCACTGCCTGTTTAAAGGG + Intergenic
1052066882 9:24032901-24032923 AAAGACACTGTTTGTTAGAAAGG + Intergenic
1052536941 9:29759843-29759865 GAAGAAACAGATTTTTTAAAAGG - Intergenic
1055192794 9:73546886-73546908 GCATACACTCTTTGTTTAAAAGG - Intergenic
1056378227 9:86034991-86035013 CTAGGCACTGATTGTCTAAATGG + Intronic
1057980449 9:99656636-99656658 AAAGACACAGATAGATTAAAAGG + Intergenic
1058498770 9:105589757-105589779 GAAGACACAGCCTGTTCAAAGGG + Intronic
1058918813 9:109593759-109593781 GGAGGAACTGATTGTTAAAAAGG - Intergenic
1059057378 9:110998158-110998180 GAGGCCACTGATTTTTTAAATGG - Intronic
1060365685 9:123010758-123010780 CACTACACTGATTGTTTAAAAGG - Intronic
1060460733 9:123852075-123852097 GAAGACACTGATTGTTTAAAAGG - Intronic
1060676550 9:125520446-125520468 AAAGACACAGATGGTTGAAATGG - Intronic
1060721581 9:125983193-125983215 GAAAACACTGGCTGTGTAAAGGG + Intergenic
1061440441 9:130599644-130599666 GAAGACAGTGAAGGTTAAAATGG - Intronic
1187313937 X:18174353-18174375 GAAGCAACTGACTCTTTAAAAGG + Intronic
1188416710 X:29944225-29944247 CAAGGCAGTGATTGTTCAAATGG + Intronic
1189456945 X:41200144-41200166 GAATAAATTGATTGCTTAAAAGG + Intronic
1189707700 X:43775932-43775954 GAAAACAATGTTTGTTTTAAAGG + Intronic
1189743485 X:44145367-44145389 GAAAACACTCATTTTTGAAAAGG + Intergenic
1192907905 X:75570953-75570975 GAGGACACAGAGTGTTTATATGG - Intergenic
1193104983 X:77661008-77661030 GAAGGCACTGAATGTTTGGAAGG - Intronic
1193110082 X:77720364-77720386 GAATTCACTGATAGTTTGAAGGG - Intronic
1193751609 X:85352454-85352476 CAAAACACTGATTGTTTAAAAGG + Intronic
1195296503 X:103483661-103483683 GTTAACACTGATTTTTTAAAAGG + Intergenic
1195377214 X:104239401-104239423 TATGCCACTAATTGTTTAAAAGG + Intergenic
1196767501 X:119261130-119261152 GTAGAGACTGATTTTATAAAAGG + Intergenic
1197055967 X:122119223-122119245 GAACAAATTGATTTTTTAAAAGG - Intergenic
1197597096 X:128478494-128478516 GAAGTCACAGCTAGTTTAAAGGG - Intergenic
1199307953 X:146289854-146289876 GGATACACTGATTTTTTGAAGGG + Intergenic
1199559137 X:149144570-149144592 AAAATCACTGATTTTTTAAATGG - Intergenic
1200040267 X:153360288-153360310 GAAGACACTTATGACTTAAATGG + Intergenic
1201769252 Y:17602658-17602680 GAAGACACTGGTTTCCTAAATGG + Intergenic
1201832302 Y:18303327-18303349 GAAGACACTGGTTTCCTAAATGG - Intergenic
1202063587 Y:20913911-20913933 GAAGTCACTGATTGGTTCACAGG - Intergenic