ID: 1060460737

View in Genome Browser
Species Human (GRCh38)
Location 9:123852114-123852136
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060460731_1060460737 18 Left 1060460731 9:123852073-123852095 CCCCTTTTAAACAATCAGTGTCT 0: 1
1: 0
2: 1
3: 24
4: 284
Right 1060460737 9:123852114-123852136 CTGTCCCGCCATTACACTCTGGG No data
1060460732_1060460737 17 Left 1060460732 9:123852074-123852096 CCCTTTTAAACAATCAGTGTCTT 0: 1
1: 0
2: 3
3: 35
4: 378
Right 1060460737 9:123852114-123852136 CTGTCCCGCCATTACACTCTGGG No data
1060460730_1060460737 19 Left 1060460730 9:123852072-123852094 CCCCCTTTTAAACAATCAGTGTC 0: 1
1: 0
2: 2
3: 28
4: 226
Right 1060460737 9:123852114-123852136 CTGTCCCGCCATTACACTCTGGG No data
1060460733_1060460737 16 Left 1060460733 9:123852075-123852097 CCTTTTAAACAATCAGTGTCTTC 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1060460737 9:123852114-123852136 CTGTCCCGCCATTACACTCTGGG No data
1060460729_1060460737 27 Left 1060460729 9:123852064-123852086 CCTGCTGGCCCCCTTTTAAACAA 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1060460737 9:123852114-123852136 CTGTCCCGCCATTACACTCTGGG No data
1060460728_1060460737 30 Left 1060460728 9:123852061-123852083 CCTCCTGCTGGCCCCCTTTTAAA 0: 1
1: 0
2: 0
3: 8
4: 127
Right 1060460737 9:123852114-123852136 CTGTCCCGCCATTACACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr