ID: 1060463666

View in Genome Browser
Species Human (GRCh38)
Location 9:123883000-123883022
Sequence CATTGTGGCTGGAGTTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 1, 2: 5, 3: 56, 4: 504}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060463666 Original CRISPR CATTGTGGCTGGAGTTCAGT GGG (reversed) Intronic
901015376 1:6226416-6226438 CTGTTTGGCTGGAGATCAGTGGG - Intronic
901376185 1:8841191-8841213 CAATGAGGCTGGAGAACAGTGGG - Intergenic
901379268 1:8862217-8862239 CACTCAGGCTGGAGTGCAGTGGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901854063 1:12032855-12032877 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
901864357 1:12094419-12094441 CAGTGTGGCTAGAGATCAGAGGG + Intronic
903444543 1:23413472-23413494 CATCCAGGCTGGAGTGCAGTGGG + Intronic
903705345 1:25281525-25281547 CAGTGAGGCTTGTGTTCAGTTGG - Intronic
903721882 1:25411805-25411827 CAGTGAGGCTTGTGTTCAGTTGG + Intronic
903775091 1:25787965-25787987 CACCCAGGCTGGAGTTCAGTGGG + Intergenic
903997659 1:27317770-27317792 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
904700071 1:32352563-32352585 CATCCAGGCTGGAGTGCAGTGGG + Intronic
904929406 1:34074414-34074436 CATTTTGGCTGGTGTATAGTGGG - Intronic
905127254 1:35724358-35724380 CAGTGTGGCTGGAGCTCGGTGGG + Intronic
905470311 1:38186907-38186929 CACCCAGGCTGGAGTTCAGTGGG + Intergenic
905576762 1:39050650-39050672 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
906413090 1:45595031-45595053 CACTCAGGCTGGAGTACAGTGGG + Intronic
906656513 1:47552284-47552306 CCTTGTGGCTGGAGCACAGTGGG - Intergenic
906827212 1:48994140-48994162 CACTGTGGCTGGAATACAGGTGG - Intronic
907135733 1:52138164-52138186 CTCTGAGGCTGGAGTGCAGTGGG + Intergenic
907221276 1:52908459-52908481 CACCGAGGCTGGAGTGCAGTTGG - Intronic
907229228 1:52980012-52980034 CATCCAGGCTGGAATTCAGTGGG + Intronic
907813931 1:57899978-57900000 CACTCAGGCTGGAGTACAGTGGG + Intronic
908543445 1:65143051-65143073 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
909180164 1:72413761-72413783 CATGGTGGCTGGACTATAGTGGG + Intergenic
909182539 1:72442460-72442482 CATTGTGGGTGGAGTTGTGGAGG + Intergenic
910926658 1:92404676-92404698 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
910983920 1:92986019-92986041 CATCCAGGCTGGAGTGCAGTGGG + Intergenic
911339942 1:96623742-96623764 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
912783025 1:112571127-112571149 CATCCAGGCTGGAGTGCAGTGGG - Intronic
914243046 1:145865255-145865277 CACTCAGGCTGGAGTGCAGTAGG - Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915176699 1:154021451-154021473 CATTCAGGCTGGAGGGCAGTGGG - Intronic
915236598 1:154487978-154488000 CACCCAGGCTGGAGTTCAGTGGG + Intronic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
918318462 1:183342772-183342794 CATCCAGGCTGGAGTGCAGTGGG + Intronic
918883969 1:190166762-190166784 CACTCAGGCTGGAGTCCAGTGGG + Intronic
920541254 1:206779786-206779808 CAATGAGGCTGGAGTGCAGAGGG - Intergenic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
920834189 1:209492868-209492890 CAGTGTAGCTAGAGCTCAGTGGG + Intergenic
920894617 1:210033750-210033772 CATTGTGCCTTGATTTTAGTAGG + Intronic
921734046 1:218606609-218606631 CACTCAGGCTGGAGTACAGTGGG + Intergenic
923724346 1:236493783-236493805 TATACTGGCTGGAGTGCAGTGGG + Intergenic
924031163 1:239887240-239887262 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1063786557 10:9391713-9391735 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
1063888489 10:10604285-10604307 CATTGTTGCTGTGGTTCACTGGG + Intergenic
1064203666 10:13304786-13304808 CACTCAGGCTGGAGTACAGTAGG - Intergenic
1064813909 10:19234697-19234719 CATAGTGTCTGGAGTATAGTAGG - Intronic
1064919598 10:20502276-20502298 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1065837534 10:29672597-29672619 CATGGTGCCTGGTATTCAGTAGG + Intronic
1065958760 10:30716384-30716406 TATTCAGGCTGGAGTTCAGTGGG - Intergenic
1067154631 10:43767584-43767606 CATTCTGGCTGGGGTGAAGTGGG + Intergenic
1069238987 10:66114836-66114858 CGCTGAGGCTGGAGTGCAGTGGG - Intronic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1069981029 10:72252754-72252776 CCTGTTGGCTGGAGTTCAGAAGG - Intergenic
1070344401 10:75527821-75527843 AATTTTGGCTGTAGTGCAGTGGG + Intronic
1071352753 10:84763151-84763173 CATTGTGGTTGGACTACAGCTGG + Intergenic
1071487349 10:86111283-86111305 CATGGTGGGTGGATTTTAGTAGG - Intronic
1071501359 10:86206478-86206500 CATCGGGGCTGGGGTTCAGGTGG + Exonic
1071896296 10:90071079-90071101 CATTCAGGCTGGAGTGCAGCTGG + Intergenic
1072120800 10:92403997-92404019 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1072218919 10:93311079-93311101 CACAGTGGCTGGCATTCAGTAGG + Intronic
1072880025 10:99217632-99217654 CATCCAGGCTGGAGTGCAGTGGG + Intronic
1073362000 10:102907282-102907304 CACCGAGGCTGGAGTGCAGTGGG + Intergenic
1073665123 10:105523087-105523109 CATTGTGACTGGAGTTTCATAGG + Intergenic
1074551330 10:114445079-114445101 CATTGGTGCTGGAGGTCAGAGGG - Intronic
1074560405 10:114530572-114530594 CATCTAGGCTGGAGTGCAGTAGG + Intronic
1075478688 10:122759905-122759927 CAAAGTGGCTAGAGTTCACTGGG - Intergenic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076150380 10:128157500-128157522 CTGCTTGGCTGGAGTTCAGTGGG + Intergenic
1077316995 11:1923873-1923895 CATGGTGTGTGGAGTTCACTGGG + Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1078229282 11:9424699-9424721 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1078823985 11:14908552-14908574 CATGGGGGCTGGAATACAGTAGG + Intronic
1079934729 11:26602708-26602730 CATTCAGGCTGGAGTACAGTGGG - Intronic
1080619983 11:33979201-33979223 CACTCAGGCTGGAGTGCAGTTGG - Intergenic
1081188665 11:40076975-40076997 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
1081199461 11:40199109-40199131 CATCCAGGCTGGAGTTCAGTGGG + Intronic
1081411449 11:42763308-42763330 GATTATTGCTTGAGTTCAGTTGG - Intergenic
1081438940 11:43058857-43058879 AATTGTGCCTGGAGCACAGTGGG + Intergenic
1081600364 11:44488509-44488531 CAGTGTGGCTGGCAGTCAGTGGG - Intergenic
1081984259 11:47290138-47290160 TATTGTTGCAGGAGATCAGTCGG + Exonic
1083056035 11:59821011-59821033 CATCCAGGCTGGAGTGCAGTGGG + Intergenic
1083174507 11:60941110-60941132 CATTGTGGCAGGTGTGCAGAGGG - Exonic
1083760202 11:64811760-64811782 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1084190334 11:67495758-67495780 CATTCTGGCAGGAGTGCAGCTGG - Intronic
1084284790 11:68123899-68123921 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1084626815 11:70313975-70313997 CATCCAGGCTGGAGTGCAGTGGG - Intronic
1087044224 11:93830791-93830813 TACTGAGGCTGGAGTGCAGTGGG + Intronic
1087169201 11:95033245-95033267 CATTGGCCCTGGAGTGCAGTAGG + Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1090450106 11:126798571-126798593 CATTTAGCCTGGAGCTCAGTGGG + Intronic
1090479660 11:127056999-127057021 CACTGTGGCTACAGTTCACTGGG + Intergenic
1090875040 11:130781412-130781434 CATCGTGCCTTTAGTTCAGTGGG - Intergenic
1091671581 12:2456010-2456032 TACTGTGTCTGGAGGTCAGTGGG - Intronic
1091978993 12:4850525-4850547 ATTAGTTGCTGGAGTTCAGTGGG + Intronic
1092224275 12:6736788-6736810 CACTCAGGCTGGAGTGCAGTTGG - Intergenic
1092249034 12:6881664-6881686 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1094085762 12:26589744-26589766 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1094436841 12:30430269-30430291 CAGTGTGGCTGGTGCCCAGTGGG - Intergenic
1094554288 12:31482996-31483018 CATTGTTGCTGGAGCAGAGTGGG - Intronic
1097135419 12:56849510-56849532 CATCCAGGCTGGAGTGCAGTGGG + Intergenic
1097818812 12:64105741-64105763 CATCCAGGCTGGAGTGCAGTGGG - Intronic
1097935026 12:65238232-65238254 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1098264910 12:68708049-68708071 CATCCAGGCTGGAGTGCAGTGGG - Intronic
1098270201 12:68762510-68762532 CATTCTGCCTGGAGTAAAGTGGG + Intronic
1100743683 12:97622663-97622685 CACCCAGGCTGGAGTTCAGTGGG + Intergenic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1101756915 12:107628179-107628201 CACTCAGGCTGGAGTACAGTGGG + Intronic
1101906495 12:108830421-108830443 CATCCAGGCTGGAGTGCAGTGGG - Intronic
1102108002 12:110342353-110342375 CATTGTGGCTGCCGTTGAGGAGG + Exonic
1102311000 12:111844229-111844251 CATCCAGGCTGGAGTGCAGTGGG + Intronic
1102311097 12:111844887-111844909 CAAGGTGGCTGGAATGCAGTGGG + Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102496796 12:113325292-113325314 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1102530708 12:113544452-113544474 GTCTGTGGCTGGACTTCAGTTGG + Intergenic
1102853121 12:116269614-116269636 CACTAAGGCTGGAGTGCAGTGGG - Intronic
1103304403 12:119952493-119952515 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
1103370192 12:120413635-120413657 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
1103600072 12:122049183-122049205 CATCCAGGCTGGAGTGCAGTGGG - Intronic
1104039846 12:125122600-125122622 CACTCAGGCTGGAGTACAGTGGG - Intronic
1104113318 12:125724809-125724831 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1104197762 12:126557185-126557207 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
1104427512 12:128690205-128690227 CAGAGTGAGTGGAGTTCAGTGGG + Intronic
1104438267 12:128774137-128774159 CATCCAGGCTGGAGTGCAGTGGG + Intergenic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1107139640 13:36984137-36984159 CACTGAGGCTGGAGTGCGGTGGG + Intronic
1107152438 13:37127860-37127882 CATAGTCAATGGAGTTCAGTCGG + Intergenic
1109597912 13:64580508-64580530 CATTCAGGCTGGAGTGCAGTGGG - Intergenic
1110321945 13:74170803-74170825 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1110425035 13:75357481-75357503 CAGTGTGGCTGGAGTTGGGGAGG - Intronic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1111013356 13:82342528-82342550 CACTCGGGCTGGAGTGCAGTGGG + Intergenic
1112128925 13:96499739-96499761 CAGTGTGGCTGAAGCTGAGTGGG + Intronic
1112557010 13:100478269-100478291 CATTGTGGCCTGTGGTCAGTGGG + Intronic
1113745715 13:112742736-112742758 CAGTGTGGCTGGATCTCAGGGGG + Intronic
1114284428 14:21226837-21226859 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1114675092 14:24434956-24434978 CATTCTGGCTGGGGTTTTGTGGG + Intronic
1115114814 14:29867479-29867501 CAGTGTTGCTGGAATTCAATGGG + Intronic
1115678673 14:35711705-35711727 CAGGGTGGTTGGAGTTCAGGTGG - Intronic
1116843166 14:49840118-49840140 CCCTGAGGCTGGAGTGCAGTTGG - Intronic
1117108884 14:52428017-52428039 CAATGTGGCTGGAGTCTAATGGG - Intergenic
1118026253 14:61772135-61772157 CACCGTGGCTGGAGCGCAGTAGG + Intronic
1118185936 14:63538576-63538598 CACTCTGGCTAGAGTTCAGTGGG - Intronic
1118293639 14:64548959-64548981 CATTCTGGCAGCTGTTCAGTTGG - Intergenic
1119531208 14:75362544-75362566 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1119874180 14:78043011-78043033 CATAGTGCCTGGAGCTCAGTAGG + Intergenic
1120121793 14:80689248-80689270 CATGCAGGCTGCAGTTCAGTGGG - Intronic
1120259711 14:82167072-82167094 CATTGCTGCTAGAGTTCATTGGG + Intergenic
1120272945 14:82337205-82337227 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
1120285898 14:82500947-82500969 CATTCTCTCTGGAATTCAGTTGG - Intergenic
1120345675 14:83286708-83286730 GATTGTGGCTGGGGTTCTGTAGG + Intergenic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1122216780 14:100209777-100209799 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
1122671502 14:103376235-103376257 CCCTGTCGCTGGAGTACAGTGGG - Intergenic
1124318274 15:28691857-28691879 CACTGAGGCTGGAGTACAGTGGG - Intergenic
1124565166 15:30805600-30805622 CACTGAGGCTGGAGTACAGTGGG + Intergenic
1124805538 15:32878226-32878248 CCGTGTGGCTGGAGTTTAGTGGG + Intronic
1125640093 15:41223377-41223399 CATTCAGCCTGGAGTGCAGTGGG - Intronic
1125981680 15:44007980-44008002 TGTTGTGGCTAGAGTGCAGTGGG + Intronic
1126039028 15:44573025-44573047 CATCCAGGCTGGAGTGCAGTGGG + Intronic
1126636486 15:50785155-50785177 CATCGAGGCTGGAGTGCAGTGGG - Intergenic
1127238037 15:57077214-57077236 CATTGAGTCTGTAGATCAGTTGG + Intronic
1127537151 15:59900649-59900671 CCTGGTGGCTGGTGTGCAGTTGG - Intergenic
1128306177 15:66600317-66600339 CATTGTGACAGGTGTGCAGTGGG + Intronic
1128576285 15:68777485-68777507 CATCCAGGCTGGAGTGCAGTGGG + Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1129719581 15:77870803-77870825 CATGGTGGCTGCATTTCAGATGG + Intergenic
1131616748 15:94024221-94024243 CACTGTGGCGGGAGGTCACTGGG - Intergenic
1132069094 15:98759823-98759845 CATTGTGGCTGAACCTCAGATGG - Intronic
1132422895 15:101689221-101689243 GACTGTGTCTGGAATTCAGTGGG + Intronic
1133365965 16:5210419-5210441 CAGTCTGGCTGGAGGACAGTGGG - Intergenic
1133417279 16:5616479-5616501 CACGGTGGCAGCAGTTCAGTGGG - Intergenic
1133559672 16:6939549-6939571 CATGCAGGCTGGAGTTCAGTGGG + Intronic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1133996929 16:10755274-10755296 CTTTGTGGCTGGAGCTGATTGGG + Intronic
1135242253 16:20818507-20818529 CGCTGAGGCTGGAGTGCAGTGGG + Intronic
1135964623 16:27025420-27025442 CATTGTACATGGAGTTCAGCAGG - Intergenic
1136537342 16:30907787-30907809 CAATGAGCCTGGAGTTCAGAGGG - Intergenic
1137365947 16:47859548-47859570 CCTTGTGGGTGGAAGTCAGTAGG - Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1138382441 16:56612131-56612153 CACCCTGGCTGGAGTGCAGTGGG + Intergenic
1138566822 16:57839497-57839519 CACCGAGGCTGGAGTGCAGTGGG - Intronic
1138690389 16:58762324-58762346 CATCCAGGCTGGAGTACAGTAGG - Intergenic
1138724193 16:59117925-59117947 CATAGTGCCTGGACTTCAGAGGG + Intergenic
1139070852 16:63380867-63380889 CATGGTTGCTGGAGTTAAATGGG + Intergenic
1140705292 16:77623190-77623212 CATTCTGGCTGGGGTAAAGTTGG + Intergenic
1142181520 16:88673264-88673286 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1142490842 17:278430-278452 CAGTGTGACTTGAGTTAAGTTGG - Intronic
1142723227 17:1791844-1791866 CACTTAGGCTGGAGTGCAGTGGG - Intronic
1143428068 17:6856033-6856055 CATGGTGGTTGTACTTCAGTTGG + Intergenic
1143844864 17:9766420-9766442 CATCCAGGCTGGAGTGCAGTGGG + Intergenic
1143967734 17:10768806-10768828 CATGGTGGCTGGTGTTCCATAGG - Intergenic
1144550602 17:16237757-16237779 TATCCGGGCTGGAGTTCAGTGGG - Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1145414506 17:22703789-22703811 CAGTGCGGCTGGGGTTGAGTTGG + Intergenic
1145757022 17:27399928-27399950 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1147329175 17:39686598-39686620 CATCCAGGCTGGAGTGCAGTGGG + Intronic
1148431466 17:47647239-47647261 CATCCAGGCTGGAGTACAGTGGG + Intergenic
1148511628 17:48175856-48175878 CTGTGTGGCTGGGGCTCAGTGGG + Intronic
1148582049 17:48750938-48750960 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
1149153436 17:53596505-53596527 GATTCTGGGAGGAGTTCAGTAGG - Intergenic
1149808300 17:59640435-59640457 CACTCAGGCTGGAGTGCAGTAGG + Intronic
1149909691 17:60555768-60555790 CACTCAGGCTGGAGTACAGTGGG + Intergenic
1150052185 17:61975678-61975700 CATCCAGGCTGGAGTGCAGTGGG - Intronic
1150552050 17:66219867-66219889 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1150583317 17:66495059-66495081 CACCGAGGCTGGAGTGCAGTGGG - Intronic
1150673991 17:67228619-67228641 CATCCTGGCTGGAGTTCAGTGGG - Intronic
1152261248 17:79268512-79268534 AACTGTGGCTGGAGCTCAGAGGG - Intronic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1153238025 18:3006957-3006979 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1153576899 18:6531323-6531345 CACCGAGGCTGGAGTGCAGTGGG - Intronic
1153736434 18:8073862-8073884 CATCCGGGCTGGAGTGCAGTGGG - Intronic
1154207486 18:12350050-12350072 CATCTGGGCTGGAGTGCAGTGGG + Intronic
1155056515 18:22188501-22188523 CATTGTGACTGGAGTGTAGGGGG + Intronic
1155160124 18:23189016-23189038 CATAGTCCCTGGAGTTCAGATGG - Intronic
1155775993 18:29762356-29762378 CAATGTGGCTGGAGTGAACTGGG - Intergenic
1156314849 18:35959638-35959660 CATGCAGGCTGGAGTGCAGTGGG - Intergenic
1156855970 18:41781633-41781655 CCTTCTGTCTGGAGTTCAGAAGG - Intergenic
1157153741 18:45244583-45244605 CACTCAGGCTGGAGTGCAGTAGG - Intronic
1158117824 18:54016312-54016334 CAATGTGGCTGGAGTTCACAGGG - Intergenic
1158467623 18:57705032-57705054 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1159065008 18:63559928-63559950 CATTGTGGGTGGAATAGAGTGGG + Intronic
1159187038 18:64988587-64988609 CACCTTGGCTGAAGTTCAGTGGG + Intergenic
1159303408 18:66607904-66607926 CACCCTGGCTGGAGTGCAGTGGG + Intergenic
1159688919 18:71460668-71460690 TAATGTGGCTGGAGCTTAGTGGG + Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160296860 18:77646521-77646543 TGTTGTGGCTGGAGTCGAGTGGG + Intergenic
1161421145 19:4176546-4176568 CATCCAGGCTGGAGTACAGTGGG - Intronic
1161503267 19:4629477-4629499 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1161627090 19:5333608-5333630 CTTTGTGGCTGGAGGTGAGGGGG - Intronic
1161748118 19:6074230-6074252 GCTTGTGGCAGGAGTTCAGGTGG + Intronic
1161820339 19:6526893-6526915 CACCGAGGCTGGAGTGCAGTGGG - Intergenic
1161822969 19:6542346-6542368 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1161932163 19:7348151-7348173 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
1162122400 19:8479505-8479527 CATCTGGGCTGGAGTACAGTGGG + Intronic
1162441171 19:10693020-10693042 AAATGAGGCTGGAGGTCAGTGGG + Intergenic
1162593893 19:11612460-11612482 CATCTAGGCTGGAGTGCAGTGGG + Intronic
1162646056 19:12051483-12051505 CACCATGGCTGGAGTGCAGTGGG + Intronic
1163566565 19:18055320-18055342 TATTCTGGCTGCAGTTCAGCTGG - Intergenic
1165133550 19:33648942-33648964 CATCCAGGCTGGAGTGCAGTGGG + Intronic
1165171810 19:33897731-33897753 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1165387220 19:35517630-35517652 CATTGTGGCTGGAGCAGTGTTGG + Intergenic
1165463175 19:35956553-35956575 CATCCAGGCTGGAGTGCAGTAGG + Intergenic
1165951858 19:39478405-39478427 CACCCTGGCTGGAGTGCAGTTGG - Intergenic
1166097228 19:40548447-40548469 CATCCAGGCTGGAGTGCAGTGGG - Intronic
1166207881 19:41284610-41284632 CATCCAGGCTGGAGTGCAGTGGG - Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166521484 19:43483314-43483336 CACTGAAGCTGGAGTGCAGTGGG + Intronic
1166548816 19:43651473-43651495 CATCCAGGCTGGAGTGCAGTGGG + Intronic
1166675200 19:44736573-44736595 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
1167204916 19:48094923-48094945 CATCCAGGCTGGAGTGCAGTGGG + Intronic
1167617799 19:50545538-50545560 CATTCAGGCTGGAGTGCAGTGGG - Intronic
1168522266 19:57061743-57061765 CATCCTGGCTGGAGTGCAGTGGG - Intergenic
925583016 2:5433262-5433284 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
925661885 2:6211372-6211394 CTCTGTGGCAGTAGTTCAGTAGG - Intergenic
928157399 2:28889038-28889060 CACCCAGGCTGGAGTTCAGTGGG - Intergenic
928519455 2:32074544-32074566 CACCCAGGCTGGAGTTCAGTGGG + Intronic
928546987 2:32337499-32337521 TGGTGTAGCTGGAGTTCAGTAGG - Intergenic
929099769 2:38300689-38300711 CACTGAGGCTGGAGTGCAGTGGG + Intronic
930593822 2:53361295-53361317 GCTTGTGGCTGAATTTCAGTTGG - Intergenic
930984294 2:57566328-57566350 CATAGTGGCTGGTAATCAGTAGG - Intergenic
932030408 2:68177865-68177887 CATCTGGGCTGGAGTGCAGTGGG - Intronic
932182290 2:69658357-69658379 CACCGAGGCTGGAGTGCAGTGGG - Intronic
932760579 2:74436711-74436733 ATTTGGGGCTGGAGATCAGTAGG - Intronic
933697116 2:85227949-85227971 CACTCAGGCTGGAGTGCAGTAGG - Intronic
933906868 2:86902947-86902969 CATCCAGGCTGGAGTACAGTGGG + Intergenic
936365299 2:111848734-111848756 CATCTAGGCTGGAGTACAGTGGG - Intronic
937466169 2:122134967-122134989 CATAGTGGCTGGAGCTGAGTGGG + Intergenic
938057128 2:128224395-128224417 CACTGAGGCTGGAGTGCAATGGG + Intergenic
938399035 2:130973446-130973468 CACTCAGGCTGGAGTGCAGTGGG - Intronic
938960060 2:136332889-136332911 GATTGTGGCTGGGGTCCAGGAGG + Intergenic
939210911 2:139174040-139174062 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
939389201 2:141544704-141544726 CACTGAGGCTGGAGTGCAGTGGG + Intronic
940061631 2:149577381-149577403 TGTTGTGGCTGGAGTGCAGAGGG + Intronic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
942206992 2:173629097-173629119 CAGTGTGGCTGGATATGAGTGGG + Intergenic
942275173 2:174316370-174316392 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
942553563 2:177147548-177147570 TATTTTGCCTGGTGTTCAGTTGG - Intergenic
944731496 2:202522116-202522138 CACTCAGGCTGGAGTGCAGTGGG - Intronic
945539155 2:211062063-211062085 AATCTTGGCTGGAATTCAGTTGG + Intergenic
945954024 2:216068183-216068205 CACTCAGGCTGGAGTGCAGTGGG - Intronic
946298621 2:218807655-218807677 CATCTAGGCTGGAGTGCAGTGGG + Intronic
946350005 2:219144158-219144180 TTTTTTGGCTGGAGTGCAGTGGG - Intronic
947351083 2:229245925-229245947 CATTTTGGCTGTAGTTTCGTTGG + Intronic
947419242 2:229926898-229926920 CATCCAGGCTGGAGTGCAGTGGG + Intronic
947468572 2:230378359-230378381 CATTGTGGCTGGAGCTTAGCAGG - Intronic
947995951 2:234528023-234528045 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948513346 2:238487835-238487857 CACTGTGGCTGGCGCTCAGGAGG - Intergenic
1168788079 20:557017-557039 CATTGAGGCTAGAGCACAGTGGG - Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1169101795 20:2956610-2956632 CACTCTGGTTGGAGTGCAGTGGG - Intronic
1170555622 20:17512677-17512699 CACTCAGGCTGGAGTACAGTGGG - Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1171392017 20:24807726-24807748 CATCCAGGCTGGAGTGCAGTGGG + Intergenic
1172037680 20:32021229-32021251 CATGGTGGCTGGAGTACAAATGG - Intronic
1172041045 20:32046156-32046178 CATTGTGGCTGGAACACAGAGGG - Intergenic
1172142849 20:32735691-32735713 CTTTCAGGCTGGAGTACAGTGGG + Intronic
1172243086 20:33426408-33426430 CACCCTGGCTGGAGTGCAGTGGG - Intronic
1172367247 20:34359449-34359471 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
1172739496 20:37154550-37154572 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1173395804 20:42678339-42678361 CATTCAGGCTGGAGTGCAGTGGG + Intronic
1173654544 20:44690595-44690617 CATCCAGGCTGGAGTACAGTGGG - Intergenic
1173747088 20:45445971-45445993 CAGTGTGGCTGGGGCTGAGTGGG + Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174867993 20:54156393-54156415 CATTGTTACTGGCTTTCAGTTGG + Intronic
1175072809 20:56348703-56348725 CATTGTGCCTGGCATTGAGTAGG + Intergenic
1177261034 21:18730250-18730272 CACTGTGGCTGGGTTCCAGTGGG - Intergenic
1178803824 21:35821868-35821890 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1179444120 21:41419739-41419761 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
1180239651 21:46492897-46492919 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1181002356 22:19993875-19993897 CATTGTGGCTGGGGCTGGGTGGG - Intronic
1181097125 22:20513110-20513132 CACTTGGGCTGGAGTGCAGTTGG + Intronic
1181558107 22:23683741-23683763 CACTGTGACTGCAGTCCAGTGGG + Intergenic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182594874 22:31411568-31411590 CATCCAGGCTGGAGTGCAGTGGG + Intronic
1184147015 22:42617706-42617728 CAGTGTGGCTGGAGGGGAGTGGG - Intergenic
1185255895 22:49831064-49831086 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
949164533 3:922513-922535 CAGTGCAGCTGCAGTTCAGTGGG - Intergenic
949595284 3:5538079-5538101 CACTCTGGCTGGGGTGCAGTGGG + Intergenic
949797775 3:7869588-7869610 CCATGTGGCTGGTGTGCAGTGGG - Intergenic
950225396 3:11229340-11229362 CATTTTTGCTGGAGTGCTGTGGG + Intronic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
951031077 3:17882301-17882323 CACTGAGGCTGGAGTGCAGTGGG + Intronic
951523370 3:23630034-23630056 CACTTAGGCTGGAGTACAGTGGG - Intergenic
951554076 3:23903152-23903174 CATCTGGGCTGAAGTTCAGTGGG + Intronic
951577311 3:24126995-24127017 CAAGATGGCTGGAGTTCAGCTGG - Intronic
952257027 3:31704488-31704510 CATGGTGGTTGGATTTCACTTGG - Intronic
955128705 3:56141388-56141410 CATGGTGGCTGGCTTCCAGTGGG - Intronic
955501074 3:59583481-59583503 GATTCTGGCTTGAGTTCATTTGG - Intergenic
955503825 3:59611381-59611403 CAGTGTGGCTGGAACACAGTGGG + Intergenic
955743337 3:62115676-62115698 CATCCAGGCTGGAGTACAGTGGG + Intronic
955961579 3:64346317-64346339 CGGTGTGGCTGGAGCACAGTGGG + Intronic
956245084 3:67173951-67173973 CCTGGTGGCAGGAGTGCAGTGGG + Intergenic
956711032 3:72039046-72039068 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
956866596 3:73375119-73375141 CAAAATGGCTGGAGTTCTGTAGG + Intergenic
956965021 3:74449224-74449246 CCTTGTGGCAGGATGTCAGTTGG - Intronic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
958980906 3:100718596-100718618 CGTTTAGGCTGGAGTACAGTGGG + Intronic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
960676314 3:120198802-120198824 CTGTGTGGCTGGAGTGGAGTGGG - Intronic
961008766 3:123422662-123422684 CATTCTGGCTGGGGTTGAGGAGG - Intronic
961402911 3:126659627-126659649 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
961569985 3:127790806-127790828 CAGGCTGGCTGGACTTCAGTAGG - Intronic
961686521 3:128636418-128636440 CATTCAGACTGGAGTGCAGTGGG - Intronic
961723647 3:128911838-128911860 CATTTTGGATGGAGTACAGTGGG - Intronic
961866890 3:129959923-129959945 CATCCAGGCTGGAGTGCAGTAGG + Intergenic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
962839640 3:139221992-139222014 CGTTGGGGCTGGGGTACAGTGGG + Intronic
962974088 3:140431113-140431135 AATGGTAGCTGGAGTTCAATGGG + Intronic
963180358 3:142348991-142349013 CACTGAGGCTGCAGTGCAGTGGG + Intronic
964311462 3:155398095-155398117 CACTCAGGCTGGAGTGCAGTGGG - Intronic
965175786 3:165330464-165330486 CACTTAGGCTGGAGTGCAGTGGG + Intergenic
965666491 3:171099495-171099517 CATGGTGTCTGGAATACAGTGGG - Intronic
966519377 3:180855948-180855970 CACTGAGGCTGGAGTGCAGTGGG - Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967046562 3:185742614-185742636 CATCCAGGCTGGAGTGCAGTGGG - Intronic
967776001 3:193386772-193386794 CATCCAGGCTGGAGTGCAGTGGG + Intergenic
968004797 3:195235144-195235166 CATCCAGGCTGGAGTGCAGTGGG + Intronic
968072861 3:195798075-195798097 CATGCAGGCTGGAGTACAGTGGG - Intronic
968333681 3:197894276-197894298 CATTGTGGGTGGACTTCACAAGG - Intronic
968530862 4:1090882-1090904 CTCTGTGGCTGGAGTTTTGTTGG + Intronic
970173014 4:13308050-13308072 CAGTGTGGCTAGAGTGCGGTGGG - Intergenic
971850375 4:31978291-31978313 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
972445582 4:39140186-39140208 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
973146681 4:46834259-46834281 CATTGATTCTGGAGTTCAGATGG + Intronic
975142395 4:70931769-70931791 CTCTGAGGCTGGAGTGCAGTGGG + Intronic
975704670 4:77099843-77099865 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
975775856 4:77786512-77786534 CACTCAGGCTGGAGTACAGTGGG + Intronic
975863299 4:78700756-78700778 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
976142077 4:82003105-82003127 CATCCAGGCTGGAGTGCAGTGGG + Intronic
976928219 4:90529253-90529275 CACTGGGGCTGGAGTGCAGTGGG + Intronic
977596311 4:98885486-98885508 CACCCTGGCTGGAGTGCAGTGGG + Intronic
978169149 4:105648343-105648365 CCTTGTTTCTGGAGGTCAGTGGG + Intronic
978871925 4:113589111-113589133 CAGTGTGGCTGGGGCTGAGTGGG + Intronic
979132772 4:117069103-117069125 CATCTAGGCTGGAGTGCAGTGGG - Intergenic
979443009 4:120774657-120774679 CAGTGTGGCTGGGGTTGTGTTGG - Intronic
979979934 4:127242549-127242571 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
982263458 4:153516864-153516886 CACTTAGGCTGGAGTGCAGTGGG + Intronic
983071712 4:163275624-163275646 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
983362097 4:166739279-166739301 CACTCAGGCTGGAGTGCAGTGGG + Intronic
983617269 4:169721853-169721875 TTTTTTGGCTGGAGTGCAGTGGG + Intronic
983670853 4:170236153-170236175 AATTGCAGCTGGAATTCAGTTGG - Intergenic
983810702 4:172057663-172057685 CACCCAGGCTGGAGTTCAGTGGG - Intronic
984747639 4:183238550-183238572 CACTGTGGCTGGATTACAGAGGG - Intronic
985164778 4:187081859-187081881 CAATGTGCCTGGAGTCAAGTAGG - Intergenic
985972673 5:3390823-3390845 CAGTGTGCATGGAGTGCAGTGGG - Intergenic
989050368 5:37314197-37314219 CATTGTGGCAGAACTTCAGAAGG - Exonic
989183830 5:38603950-38603972 TATTGTGGCTGGAGATCATTAGG - Intronic
989630472 5:43477149-43477171 CATTTAGGCTGGAGTGCAGTAGG - Intronic
991335008 5:65537343-65537365 CATCCAGGCTGGAGTCCAGTAGG + Intronic
992853223 5:80832576-80832598 CACCGAGGCTGGAGTGCAGTGGG - Intronic
993353752 5:86881201-86881223 CATTGTGGGTGGGGCCCAGTGGG - Intergenic
995209104 5:109516489-109516511 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
995853323 5:116569691-116569713 CATTGTGGCTGCAATGCTGTTGG - Intronic
996882351 5:128313941-128313963 GATGGTGGCTGGAACTCAGTTGG - Intronic
997399489 5:133591470-133591492 TATTGTGGGTGGAGGACAGTTGG - Intronic
997914214 5:137908265-137908287 CATCCAGGCTGGAGTGCAGTGGG - Intronic
998665652 5:144294116-144294138 CATTCAGGCTGGAGTGTAGTGGG - Intronic
998921336 5:147071506-147071528 CAGTGTGTCTGAAGTTGAGTAGG - Intronic
999251655 5:150185951-150185973 CAGAGTGTGTGGAGTTCAGTGGG - Intergenic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
1000398234 5:160798217-160798239 CACTGTGGCTAGAGCTCAGCTGG + Intronic
1000732510 5:164853865-164853887 AATTGATGCTGGAGTTCTGTAGG - Intergenic
1000966963 5:167668910-167668932 CACTCAGGCTGAAGTTCAGTGGG - Intronic
1001961647 5:175883497-175883519 CCTTGTGGCTAGAGTACAGTGGG + Exonic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1002329696 5:178432986-178433008 CATGGTAGCTGGAGTTCCCTTGG + Intronic
1002515427 5:179754547-179754569 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1002963209 6:1936924-1936946 CATTCAGGCTGGATTGCAGTGGG - Intronic
1003078790 6:3004443-3004465 CATTGTGGCTGAAGCTGAGTTGG - Intronic
1003717496 6:8664853-8664875 GATTCTGGATGGAGTTCATTTGG + Intergenic
1004630558 6:17417314-17417336 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1005175917 6:23044816-23044838 CAATGTGGATAGAGCTCAGTGGG + Intergenic
1005210528 6:23455257-23455279 CATTTAGGCTGGAGTGCAGTGGG + Intergenic
1006881478 6:37343725-37343747 CATTGATGCTGGATGTCAGTTGG + Intergenic
1010307077 6:74337632-74337654 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1011074581 6:83425051-83425073 CATACAGGCTGGAGTGCAGTGGG + Intronic
1011547704 6:88499296-88499318 CACTGTGGCTGGAATTGGGTGGG + Intergenic
1011605604 6:89102182-89102204 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1011810056 6:91121040-91121062 CATTTTGGCTGGAGTTCAGGAGG + Intergenic
1012276379 6:97279743-97279765 CACCCTGGCTGGAGTGCAGTGGG - Intronic
1012669874 6:102030854-102030876 CATTAAGTCTGGAGTTCAGAGGG - Intronic
1012952385 6:105532263-105532285 CAATTTGGCTGGAGCTCAGAGGG + Intergenic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1014248539 6:119093184-119093206 CTTTGTGGAGGGAGTACAGTAGG + Intronic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015340756 6:132097796-132097818 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1015532681 6:134236584-134236606 CATCCAGGCTGGAGTGCAGTGGG - Intronic
1015540111 6:134305317-134305339 CAGGCTGGCTGGAGTGCAGTGGG - Intronic
1016918824 6:149271165-149271187 CACTCAGGCTGGAGTACAGTGGG - Intronic
1017160586 6:151361956-151361978 CAGTTTGGCTGGAGATCCGTGGG + Intergenic
1018225458 6:161624364-161624386 CATTTTGGCTTAAGTACAGTAGG - Intronic
1018377116 6:163223491-163223513 CATTGTGTGTGGAGCTCAGTGGG - Intronic
1018675230 6:166215199-166215221 CATACAGGCTGGAGTGCAGTGGG - Intergenic
1018776400 6:167020866-167020888 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1018967529 6:168500244-168500266 CATCCGGGCTGGAGTGCAGTGGG - Intronic
1020147932 7:5659461-5659483 CAGTATGGCTGGAGCCCAGTGGG + Intronic
1020363763 7:7357616-7357638 CATCCAGGCTGGAGTGCAGTGGG - Intronic
1020512884 7:9081911-9081933 CACTTAGGCTGGAGTGCAGTGGG + Intergenic
1022213412 7:28234112-28234134 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1022240020 7:28501749-28501771 AATTGTGGCTTGATTGCAGTTGG + Intronic
1023114163 7:36844274-36844296 CATGCAGGCTGGAGTGCAGTGGG - Intergenic
1023169126 7:37373566-37373588 CATCCAGGCTGGAGTGCAGTGGG - Intronic
1023179856 7:37470725-37470747 CATCTAGGCTGGAGTGCAGTTGG - Intergenic
1023824469 7:43999825-43999847 CGTGGTGCCTGGAGATCAGTTGG + Intergenic
1025076578 7:55949103-55949125 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1025851574 7:65248947-65248969 CATTCAGGCTGGAGTGCAGTAGG + Intergenic
1025916489 7:65870819-65870841 CATCCAGGCTGGAGTGCAGTGGG + Intergenic
1026088018 7:67278589-67278611 CGTGGTGCCTGGAGATCAGTTGG + Intergenic
1026138542 7:67684961-67684983 CACTCAGGCTGGAGTTCAGTGGG + Intergenic
1026331598 7:69356788-69356810 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1026726224 7:72871684-72871706 CGTGGTGCCTGGAGATCAGTTGG - Intergenic
1027023958 7:74837234-74837256 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1027063972 7:75108087-75108109 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1027117621 7:75493923-75493945 CGTGGTGCCTGGAGATCAGTTGG + Intergenic
1027122944 7:75535286-75535308 CACTCAGGCTGGAGTGCAGTGGG + Exonic
1027167618 7:75846878-75846900 CATCCAGGCTGGAGTGCAGTGGG + Intronic
1027274182 7:76541562-76541584 CGTGGTGCCTGGAGATCAGTTGG - Intergenic
1027327626 7:77060615-77060637 CGTGGTGCCTGGAGATCAGTTGG - Intergenic
1028615846 7:92766000-92766022 CACTGTGGCTGGAGAACCGTGGG + Intronic
1028855734 7:95590976-95590998 CACTTGGGCTGGAGTGCAGTGGG + Intronic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029719879 7:102356126-102356148 CGTGGTGCCTGGAGATCAGTTGG - Intergenic
1029752734 7:102553131-102553153 CGTGGTGCCTGGAGATCAGTTGG + Exonic
1029770685 7:102652224-102652246 CGTGGTGCCTGGAGATCAGTTGG + Exonic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1029999302 7:105042036-105042058 CATCCAGGCTGGAGTGCAGTAGG + Intronic
1031492662 7:122408463-122408485 CACTTGGGCTGGAGTGCAGTGGG + Intronic
1031661393 7:124429420-124429442 CATAGTACCTGGAGTTTAGTAGG - Intergenic
1031986060 7:128165573-128165595 GATTTTGGCTGCAGCTCAGTGGG + Intergenic
1032259964 7:130327615-130327637 CACCAAGGCTGGAGTTCAGTGGG + Intergenic
1032411603 7:131697571-131697593 CAGTGTGGCTGAAGTGGAGTAGG + Intergenic
1032491925 7:132330218-132330240 CAATTTGGCTGGAGCTGAGTAGG + Intronic
1032882071 7:136100476-136100498 CATGGTGGGTGGGGTTGAGTGGG + Intergenic
1035183816 7:157110569-157110591 CATCTAGGCTGGAGTGCAGTGGG + Intergenic
1036795218 8:11750904-11750926 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1036815646 8:11901077-11901099 CATTGTGGCTAGAAATCTGTTGG + Intergenic
1037026440 8:14044010-14044032 CATCCAGGCTGGAGTGCAGTAGG + Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1038071381 8:24018080-24018102 CATCCAGGCTGGAGTGCAGTGGG + Intergenic
1038470127 8:27808642-27808664 CACTCAGGCTGGAGTACAGTGGG - Intronic
1038705816 8:29892874-29892896 CATCCAGGCTGGAGTGCAGTGGG + Intergenic
1038807631 8:30809894-30809916 CAGTCAGGCTGGAGTGCAGTGGG - Intronic
1038960060 8:32508774-32508796 CACTCAGGCTGGAGTGCAGTGGG + Intronic
1039868046 8:41522800-41522822 CTCTCTGGCTGGAGTGCAGTGGG - Intergenic
1039893599 8:41700801-41700823 CACCCTGGCTGGAGTGCAGTGGG + Intronic
1040489512 8:47906590-47906612 CACTGTGTCTGGAGTGCAGTGGG - Intronic
1040902054 8:52427548-52427570 CATTGGGGTGGGAGATCAGTGGG + Intronic
1042318785 8:67452905-67452927 CAATGTGGCTGGAGCCAAGTGGG + Intronic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042503095 8:69530932-69530954 CATTCTGTCTGGAGTACAGTAGG - Intronic
1042542024 8:69916852-69916874 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1042596294 8:70451365-70451387 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
1042600503 8:70494745-70494767 CGCTGTGGCTGGAGTTCTCTGGG + Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1044882176 8:96734668-96734690 CATCCAGGCTGGAGTGCAGTGGG - Intronic
1044991008 8:97795794-97795816 CGCTGAGGCTGGAGTGCAGTGGG - Intronic
1045200427 8:99974755-99974777 CATCCAGGCTGGAGTGCAGTGGG - Intronic
1045249628 8:100472686-100472708 CAGGGTGGATGGAGTTGAGTGGG - Intergenic
1045371790 8:101531692-101531714 CATTGTTTCTAGAGCTCAGTGGG + Intronic
1046084416 8:109415036-109415058 CACCGTGGCTGGAGTGCTGTGGG + Intronic
1046233835 8:111394319-111394341 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
1046605248 8:116364504-116364526 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
1047739230 8:127793992-127794014 CACTGGAGCTGGAGCTCAGTCGG + Intergenic
1048440134 8:134453626-134453648 CATTGAGGCTGGAAATCAGTTGG - Intergenic
1049143285 8:140977654-140977676 CACTTAGGCTGGAGTCCAGTTGG - Intronic
1049635928 8:143689420-143689442 CACTGTGGCAGGAGGGCAGTGGG + Intronic
1049718622 8:144105284-144105306 CATGGTGGCTGGAGCTCTTTTGG + Intronic
1050135047 9:2453883-2453905 CTTTGACGCTGGAGTTAAGTAGG - Intergenic
1050436194 9:5613311-5613333 CACTTAGGCTGGAGTGCAGTGGG + Intergenic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1051213806 9:14775115-14775137 CATTGTGGTGAGAATTCAGTAGG - Intronic
1051287860 9:15514225-15514247 CACCCTGGCTGGAGTGCAGTGGG - Intergenic
1051362226 9:16291372-16291394 CATGGTGACTGTAGTACAGTGGG + Intergenic
1052758180 9:32563380-32563402 CAGGATGGCTGGAGTACAGTGGG + Intronic
1053121891 9:35553699-35553721 AAGTGTGGCTGGAGCACAGTGGG + Intronic
1053275526 9:36780524-36780546 GATTGTGGCTGGAGGACTGTGGG - Intergenic
1055542597 9:77328178-77328200 CATTGTCACTGGAGTTCTGATGG - Intronic
1057363694 9:94398852-94398874 CACTGAGGCTGGAGTGCAGTGGG + Intronic
1057472989 9:95374570-95374592 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1057659641 9:96989235-96989257 CACTGAGGCTGGAGTGCAGTGGG - Intronic
1057827681 9:98383270-98383292 CCTTGTGGGTGTGGTTCAGTGGG - Intronic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1059159232 9:112018449-112018471 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1060036849 9:120263148-120263170 CACTGGGGCTGGTGTTCAGATGG - Intergenic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1060804627 9:126566895-126566917 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1060877737 9:127095355-127095377 CACTCAGGCTGGAGTGCAGTGGG - Intronic
1061652553 9:132062656-132062678 CACTCAGGCTGGAGTACAGTGGG + Intronic
1062215798 9:135389211-135389233 CAGGGTGGCTGGAGCTCAGGAGG - Intergenic
1186405135 X:9295117-9295139 CATCCAGGCTGGAGTGCAGTGGG - Intergenic
1186496763 X:10016689-10016711 CATTCTGGCTGCAGTACAGAAGG - Intronic
1186895166 X:13998114-13998136 CATTCTGACTGGAGTGCAGTGGG + Intergenic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1189337309 X:40177670-40177692 CATTGTGGCTGGCATATAGTAGG + Intergenic
1190211176 X:48449310-48449332 CATCCAGGCTGGAGTGCAGTGGG + Intergenic
1191015519 X:55805901-55805923 CATTGTGGATAGAATTCAGTAGG - Intergenic
1191210457 X:57879334-57879356 CAGTGTTGCTGAAGTTCAGATGG - Intergenic
1193127934 X:77889410-77889432 CAGGCTGGCTGGAGTGCAGTGGG + Intronic
1193987922 X:88269388-88269410 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1194442233 X:93946780-93946802 CATTCTGACTGGAGTTGAGATGG - Intergenic
1194476307 X:94363952-94363974 CACTCAGGCTGGAGTGCAGTGGG + Intergenic
1195034735 X:100961996-100962018 GGTTGGGGCTGGAGTCCAGTGGG + Intergenic
1195397016 X:104422076-104422098 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1195735357 X:108007386-108007408 CACTCAGGCTGGAGTGCAGTGGG - Intergenic
1195989341 X:110667215-110667237 CCTTCAGGCTGGAGTGCAGTGGG + Intergenic
1197270048 X:124415366-124415388 AATTCTGGCTGGAGTTAAGAAGG + Intronic
1197805902 X:130398368-130398390 CAGTGTGGCTGGAGAGGAGTAGG - Intergenic
1198529697 X:137539877-137539899 CTCTCTGGCTGGAGTGCAGTTGG + Intergenic
1198839074 X:140836831-140836853 CATTGTGGGTGGAGTGCGGGTGG + Intergenic
1199094344 X:143722635-143722657 CCTTGTGTCTGGAGGTCAGCGGG - Intergenic
1200051263 X:153433096-153433118 CTGTGTGGCTGGAGGCCAGTGGG + Intergenic
1201101350 Y:10677668-10677690 CACACTGGCTGGAGTGCAGTGGG + Intergenic
1201463836 Y:14257813-14257835 CACTGAGGCTGGAGTGCAGTGGG - Intergenic
1201953126 Y:19586947-19586969 CATCCAGGCTGGAGTGCAGTGGG - Intergenic