ID: 1060465524

View in Genome Browser
Species Human (GRCh38)
Location 9:123901381-123901403
Sequence ATTTTTAATAGGAGGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 289}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060465524 Original CRISPR ATTTTTAATAGGAGGGTAGA GGG (reversed) Intronic
900856343 1:5188072-5188094 CTTTGTAATAACAGGGTAGAAGG - Intergenic
901115662 1:6841816-6841838 ATTTTTAATAGAACAGCAGAAGG + Intronic
903275352 1:22218083-22218105 GTTTTTAATAAGAGGGCAGGAGG - Intergenic
903920940 1:26800244-26800266 ACTGTTAATAGGATGGTAAAAGG - Intergenic
906684304 1:47753063-47753085 AGTTTTATTAAGAGGTTAGAGGG + Intergenic
908423882 1:63986226-63986248 ATTTTTAAAAGGGAGGTAGAGGG - Intronic
911011919 1:93289359-93289381 ATTTTAAAATGGAGGGCAGAAGG + Intergenic
911706326 1:101017559-101017581 ATTTTTATCAGGAGGGAAAAAGG - Intronic
912999114 1:114562157-114562179 CTTTTTAAGAGGGAGGTAGAAGG - Intergenic
913568092 1:120093156-120093178 ATTTTTATCAAGAGGGTTGAAGG - Intergenic
914288902 1:146254180-146254202 ATTTTTATCAAGAGGGTTGAAGG - Intergenic
914549937 1:148704923-148704945 ATTTTTATCAAGAGGGTTGAAGG - Intergenic
914616804 1:149367103-149367125 ATTTTTATCAAGAGGGTTGAAGG + Intergenic
914983628 1:152438403-152438425 ATATTTGATGGGTGGGTAGATGG - Intergenic
915321043 1:155056683-155056705 ATTTCTTAGAGGAGGGTAGGAGG + Intronic
916716306 1:167449561-167449583 ATTATTAATATGATGGCAGATGG + Intronic
917999571 1:180479575-180479597 ATGTTTGATAGCAGAGTAGAGGG + Intronic
918338333 1:183544840-183544862 TTTTTTAACAGGTAGGTAGAGGG - Intronic
918491588 1:185087166-185087188 ATTTTTTATAGCAGGCTAAATGG - Intronic
919486047 1:198148354-198148376 ATTTTAAATAAGATGGTAGACGG - Intergenic
920715334 1:208335273-208335295 ATTATTAATGGGATGGGAGAGGG + Intergenic
921254282 1:213325429-213325451 TCTTTTAGTAGGAGGGTGGAAGG - Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921998333 1:221446604-221446626 ATTTTAAATAGGAGGAAGGAAGG + Intergenic
922322269 1:224499128-224499150 ATTTTTAAAAGGCGGGGAGTAGG - Intronic
1063505075 10:6590467-6590489 ATATTTAAAAGGAGGGTTGGTGG + Intergenic
1065175178 10:23068526-23068548 ATTTTTTATAAGAAGGTAGGTGG + Intergenic
1065987490 10:30969723-30969745 ATGTTTAATAGGATGGAACATGG - Intronic
1066285743 10:33964419-33964441 ATTTTTAGGAGGATGCTAGAAGG + Intergenic
1066975863 10:42367434-42367456 ATTTTTAACAGGAGAAAAGAGGG + Intergenic
1070639426 10:78156788-78156810 ATTTCTAATATGAGTGTAGGTGG - Intergenic
1071410935 10:85394584-85394606 ATTATTAATTGCAGGGCAGAAGG + Intergenic
1072675998 10:97466641-97466663 ATTTCTAATAAGAGCTTAGAAGG - Intronic
1073161081 10:101395950-101395972 ATTTTTTATATGATGGGAGAAGG + Intronic
1074916057 10:117956070-117956092 ATTTTTAAAATGAAGGTAGGTGG + Intergenic
1076194626 10:128508282-128508304 AGTTTTAATATGAGGTTTGAAGG + Intergenic
1078759594 11:14241761-14241783 ATATTTCTTAGGAGGGAAGAAGG + Intronic
1079815087 11:25046245-25046267 ATGATTATTAGGAAGGTAGAAGG + Intronic
1080427315 11:32168156-32168178 ATTTTTAAAAGGCAAGTAGATGG - Intergenic
1081276341 11:41153886-41153908 CTTTATAAAAGGAGGGTAAAGGG + Intronic
1082955973 11:58870179-58870201 ATTTTTAATAGGATGGTCAAAGG + Intronic
1082963497 11:58941582-58941604 ATTTTTAATAGGATGGCCAAAGG + Intronic
1084213795 11:67635941-67635963 TTTTTTAATTGGAGGGGTGAAGG - Intronic
1085142636 11:74161607-74161629 TTTTTTAAGACGTGGGTAGAGGG + Intronic
1085220478 11:74870071-74870093 ATTTTAAAATGGAGGGCAGAAGG - Intronic
1086285300 11:85242119-85242141 ATCTTTAATAGGAGAATAAATGG + Intronic
1088228429 11:107647001-107647023 ATTTTGAATAGGAAATTAGATGG - Intronic
1088288954 11:108215170-108215192 ATATTTAATAGTAGGGAATAGGG - Intronic
1088952562 11:114586424-114586446 ATTTTTAAATGGAGAGCAGAAGG - Intronic
1090180389 11:124693252-124693274 ATTTATAATAGGGGGATAGGAGG + Intronic
1092726867 12:11495603-11495625 ATTTTTAATAGGATAGTAGCTGG + Intronic
1092941167 12:13408500-13408522 TTTTTTAATAGGGGGATAAAGGG - Intergenic
1094179995 12:27582351-27582373 TTTTTTAAGAAGAGGGGAGAGGG + Intronic
1095543619 12:43340393-43340415 ATTTGTCATAGTAGGGAAGATGG - Intergenic
1096087488 12:48875434-48875456 ATTTTTAATAGGGGTTTAGCTGG - Intergenic
1096900964 12:54881637-54881659 TTTTTAAATGGGAGAGTAGATGG + Intergenic
1097332627 12:58348862-58348884 ATTTTTAATAGGAGATTATAAGG - Intergenic
1097481601 12:60133293-60133315 ATTTTCAATTGTAGGCTAGAAGG + Intergenic
1098078187 12:66756011-66756033 ATTTTTAAAAGGATGGGGGAAGG - Intronic
1098553445 12:71791476-71791498 GTTTTTTATTGGAGGGAAGAAGG + Exonic
1098786550 12:74765291-74765313 TTTTTTAATCAGAGGTTAGATGG - Intergenic
1098989500 12:77049164-77049186 ATTTCTAATGGGAGGGTATATGG - Intronic
1099008051 12:77259169-77259191 ATTTTTAATAGGATGGTCAAGGG + Intergenic
1099695998 12:86020226-86020248 ATGTTGAATAGGAGTGTTGAGGG + Intronic
1100036273 12:90256207-90256229 ATTTTTTATAGCAGGATAGCAGG + Intergenic
1101145862 12:101839851-101839873 ATTTTTAAAAGGACGGAGGAAGG + Intergenic
1102423376 12:112821629-112821651 ATTTTAAATAGGTGGTCAGAGGG - Intronic
1102680954 12:114690272-114690294 AATTTTACTTGTAGGGTAGAGGG + Intergenic
1103180740 12:118909092-118909114 ATTTTTAATGGGAGACTAGGGGG + Intergenic
1103210609 12:119163567-119163589 ATTTTTAGTAGGGGTTTAGATGG - Intergenic
1103813539 12:123634770-123634792 AGATTTAAAAGGAGGCTAGAGGG + Intronic
1108112791 13:47094650-47094672 AAATTAAATAGGAGGGGAGAAGG - Intergenic
1108500050 13:51061430-51061452 ATTTTTAAAATGGGGGTAGGAGG + Intergenic
1110048560 13:70862008-70862030 ATTTTTAAAAATATGGTAGAAGG - Intergenic
1111744492 13:92249633-92249655 ATTTTTAGTGGGGGGGTTGATGG + Intronic
1112101616 13:96196225-96196247 GATTTGAGTAGGAGGGTAGAAGG - Intronic
1116931931 14:50699449-50699471 ATGTTGAATAGGAGGGGTGAAGG + Intergenic
1118685008 14:68282557-68282579 ATTTTTAAAAGGAGGGGTGGGGG - Intronic
1118786630 14:69051254-69051276 ATTTTTAATAGCAGGACAGATGG - Exonic
1119676719 14:76561244-76561266 ATTTGTAAAAGGAGGGAAGAAGG + Intergenic
1120388146 14:83871411-83871433 ATTTTAAATGGGAAGGAAGAAGG + Intergenic
1120488715 14:85148990-85149012 ATTTTTAGAAAGAGGGAAGAAGG + Intergenic
1120678431 14:87450357-87450379 ACTTTTAACAGGAGAGGAGAAGG - Intergenic
1120778548 14:88464161-88464183 ATTTTAGATAGTAGGGTAAATGG + Intronic
1120779088 14:88469722-88469744 ATCTTTAACAGGAGGGTGGAAGG - Exonic
1120857170 14:89222790-89222812 TTTTTTAAAGGAAGGGTAGAGGG - Intronic
1121234455 14:92382033-92382055 ATTTTAAATAGCAGGAAAGATGG - Intronic
1123805038 15:23861814-23861836 ATTTGAAATAGGAGAGTAGGTGG + Intergenic
1124583709 15:30986011-30986033 ATTTTTCAGAGGATGGTGGAAGG + Intronic
1125263970 15:37858303-37858325 ATTTTTAATAAGAGGCAAGGGGG + Intergenic
1125897646 15:43315968-43315990 CTTTTTAATAGGAGTGGAAAAGG - Intergenic
1129542127 15:76359000-76359022 CTTTATAAAATGAGGGTAGATGG + Intronic
1129981964 15:79881058-79881080 ATTTTTAAGAGGAGTGAAGTTGG - Intronic
1130813512 15:87406622-87406644 ATTTATAATAGAAGGATGGAAGG + Intergenic
1133513946 16:6488906-6488928 ATTTTTCAAGAGAGGGTAGAAGG + Intronic
1133825086 16:9271115-9271137 ATGTATAATAGGTGGGTGGATGG - Intergenic
1133983081 16:10648048-10648070 ATTTTTAACAGGAGGTGGGAGGG - Intronic
1135169502 16:20170824-20170846 GTTTTTAAGTGGAGGGTAGGAGG + Intergenic
1135919953 16:26640993-26641015 ATTTTTCATGGGTAGGTAGATGG - Intergenic
1136586900 16:31192244-31192266 CTTTTTGATTGGAGGGTGGAAGG + Exonic
1136709644 16:32226239-32226261 TTTTTTAATAGGAACTTAGATGG - Intergenic
1136758265 16:32703172-32703194 TTTTTTAATAGGAACTTAGATGG + Intergenic
1136809843 16:33167203-33167225 TTTTTTAATAGGAACTTAGATGG - Intergenic
1136816319 16:33277283-33277305 TTTTTTAATAGGAACTTAGATGG - Intronic
1137268194 16:46885376-46885398 ATTTTAGGTAGGAGGGGAGACGG + Intronic
1137870298 16:51943902-51943924 ATGTTTATTAGGAGCTTAGAAGG + Intergenic
1140440887 16:74986653-74986675 ATTTTTAACAGCAGTGTAAAGGG + Intronic
1140814670 16:78610227-78610249 ATTATGAAAAGGAGGGTAAAAGG - Intronic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1203060416 16_KI270728v1_random:963521-963543 TTTTTTAATAGGAACTTAGATGG + Intergenic
1143671858 17:8402161-8402183 ATTTTTAATAATTGGATAGATGG + Intergenic
1143943951 17:10572874-10572896 ATTTTTAAAAGGTGGGAAGAGGG + Intergenic
1144449364 17:15363148-15363170 ATTTTTAATTGGATGGTGGTAGG + Intergenic
1145352761 17:22101235-22101257 ATTTTTAATAAAAGGATAAAAGG + Intergenic
1146640962 17:34541251-34541273 ACTTTGTATAGGAGGGGAGAGGG - Intergenic
1147544897 17:41393739-41393761 ATATTTATTAGGAGGTTAAAAGG + Exonic
1148377398 17:47160539-47160561 CTTTTAAATAGGAGGATGGAAGG + Intronic
1149535267 17:57428873-57428895 ATTATTACTAGGAGAGCAGAAGG - Intronic
1150054156 17:61996438-61996460 AGTTTTCATAGGATGGTATAAGG - Intronic
1151005152 17:70427029-70427051 ATGTCCAATAGGAGGGTAGGAGG - Intergenic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1155343217 18:24833875-24833897 ATTTTTAATTGGATGTGAGATGG - Intergenic
1155439319 18:25844875-25844897 AATTGTAATAGGAGGACAGAAGG - Intergenic
1156302372 18:35846862-35846884 AATTTTAATGGGATGGTAAAGGG - Intergenic
1158804234 18:60950301-60950323 ATGTTTGATAGTAGAGTAGAAGG - Intergenic
1161560029 19:4968180-4968202 ATTCTCAAGAGGCGGGTAGACGG + Intergenic
1162877071 19:13628307-13628329 ATTTTTAAAAGGAGAGGAGAGGG + Intergenic
1164176914 19:22783618-22783640 ATTTTTAATAGGAGAAAAGAGGG + Intronic
1164199147 19:23002630-23002652 ATTTTTAATAGGAGAAAACAGGG + Intronic
1164411298 19:28007957-28007979 GTTTTTAAAAGGTGGGTAGGAGG - Intergenic
1164597903 19:29542130-29542152 ATTATAAATAGATGGGTAGATGG + Intronic
1165723033 19:38093170-38093192 ATTTTTAACAGGAAGGTCAAGGG + Intronic
925395523 2:3530620-3530642 ATTATTAGTAGGGGGGAAGAAGG + Intergenic
925395534 2:3530723-3530745 ATTATTAGTAGGAGGGAAGAAGG + Intergenic
925395545 2:3530829-3530851 ATTATTAGCAGGAGGGAAGAAGG + Intergenic
925395551 2:3530892-3530914 ATTATTAGTAGGAGGGAAGAAGG + Intergenic
925395564 2:3530995-3531017 ATTATTAGTAGGGGGGAAGAAGG + Intergenic
926718312 2:15941497-15941519 ATTTTTACAAAGGGGGTAGAAGG + Intronic
927761278 2:25757329-25757351 ATTCTTAATAGGAGGTTACTTGG - Intronic
928681070 2:33702653-33702675 ACTTATAATAGGAAGGTGGAGGG - Intergenic
930428681 2:51245792-51245814 ATTTTATACAGGAGGGAAGAAGG - Intergenic
930450744 2:51534349-51534371 ATTGTTAAGATGAGGGCAGATGG - Intergenic
932259942 2:70318584-70318606 ATTCTTAATGGAAGGGCAGAGGG + Intergenic
933347756 2:81110979-81111001 ATATTGAATAGGAGTGTAGAGGG - Intergenic
933526237 2:83443608-83443630 ATTTTTTATTGGAGGGGAGATGG - Intergenic
933528287 2:83472499-83472521 ATTTTTATGACGAGGGTACAAGG + Intergenic
933863940 2:86499153-86499175 ATCTTTGATAGGAGATTAGACGG + Intergenic
935606455 2:104976257-104976279 ATTCTTTATAGGAGATTAGAAGG - Intergenic
936617406 2:114062016-114062038 ATTGTTAATAGGATGGTTGGGGG - Intergenic
936761995 2:115797674-115797696 CTTGTTAATAGAAGGGGAGAAGG + Intronic
937702220 2:124876455-124876477 TTTTTTAAGAGGAGAGAAGAGGG + Intronic
937895702 2:126975405-126975427 GTTTTTAATAGCAGGGAAGGTGG - Intergenic
938256797 2:129865562-129865584 TTTTTTAAAAGCAGGGTTGATGG - Intergenic
939156498 2:138531195-138531217 ATTTTTAAAAGGAGAGAAAAAGG - Intronic
939476169 2:142689902-142689924 ATTTTTAATGGGATAATAGATGG - Intergenic
939610527 2:144304147-144304169 ATTTGGAATAGAAGAGTAGACGG + Intronic
939837142 2:147144114-147144136 ATTTTTAATTTGTGGGTACATGG - Intergenic
941561012 2:167044379-167044401 ATGTTTAATAGGAGCGGTGAGGG - Intronic
941802674 2:169677947-169677969 ATTTTTAATATTATGGTAAATGG - Intronic
942155877 2:173126717-173126739 ATTTTTATTAGCAGTCTAGAGGG + Intronic
942161802 2:173196711-173196733 ATTTCTAATAGGAACGTAGATGG - Intronic
943008264 2:182413365-182413387 ATTTTAAATGGGAGGCTAGAGGG + Intronic
945498774 2:210542512-210542534 CCTTTTAACAGGAGGGTAGGAGG - Intronic
945588115 2:211692676-211692698 CTTTATAAGAGGAAGGTAGAGGG - Intronic
947136097 2:226978301-226978323 ATTTTTAATGGGGGGCTAGCAGG - Intronic
1169498513 20:6137042-6137064 ATTGTGAATGGGAGAGTAGAAGG - Intergenic
1170059250 20:12242309-12242331 GTTTTAAATAGGAAGGTAGATGG - Intergenic
1171288924 20:23968851-23968873 TTTTTGAATAGGAGGGCTGAAGG + Intergenic
1171563080 20:26146600-26146622 ATTTTTAATAAAAGGATAAAAGG + Intergenic
1172436979 20:34936045-34936067 ATTTTTAATGGCAGGGGTGAAGG + Intronic
1172689866 20:36782969-36782991 ATTCTAGATAGGAGGGGAGAGGG + Exonic
1173743920 20:45421806-45421828 ATTCTTAATAGGACTGTACAAGG + Intronic
1175653756 20:60751005-60751027 ATATTTAACAGAAGGGAAGAAGG + Intergenic
1177101975 21:16909142-16909164 ATTTTTTCTAGGAGGAAAGATGG - Intergenic
1177392084 21:20488671-20488693 ATTTTTATTAAGATGGTACATGG + Intergenic
1178150299 21:29786470-29786492 ATTTAGAATAGGGGTGTAGAGGG - Intronic
1178258046 21:31073297-31073319 ATTTTTAATAGGATGGGATTCGG - Intergenic
1184435876 22:44475563-44475585 ATTTTAAATGGGAGGGTAAATGG - Intergenic
1184630147 22:45770995-45771017 ATTTTGCATTGGAGGGAAGAAGG - Intronic
951099352 3:18668760-18668782 ATTTTGAAGATGAGGGGAGAGGG - Intergenic
951804172 3:26626272-26626294 TTTTTAAATAGGAAGGTAAATGG + Intronic
956890287 3:73606676-73606698 ATTGTAAATATGAAGGTAGATGG - Intronic
957303535 3:78425232-78425254 TTTTTTAATGGGAGGACAGAAGG - Intergenic
957449534 3:80360470-80360492 CCTTTTCAGAGGAGGGTAGAGGG + Intergenic
959800214 3:110485238-110485260 ATTTGTAATAAAAGGGGAGAGGG + Intergenic
960136836 3:114114065-114114087 ATTTTAAAAATGACGGTAGATGG + Intergenic
960230960 3:115226851-115226873 AATTTTAATAGCAGGATAAAAGG + Intergenic
962570666 3:136710054-136710076 ATTTTTAAAAGGTGGGGAGGAGG + Intronic
964721687 3:159773292-159773314 ATTTTCAATAGAAGGGTAATAGG + Intronic
965798007 3:172461577-172461599 ATTTTGAAGAGGAAGGTAGGGGG - Intergenic
966351457 3:179036549-179036571 ATATTGGATAAGAGGGTAGAAGG + Intronic
967196280 3:187028922-187028944 ATTTTTCATAGGTGGTTAGCAGG + Intronic
970925518 4:21447168-21447190 ATCTTTAACAGAAAGGTAGAAGG + Intronic
972168128 4:36312006-36312028 ATCTCTAATAGGAAGGAAGATGG + Intronic
972423065 4:38907492-38907514 ATTTTTCATAGGATGTTAGCAGG + Intronic
974269960 4:59637719-59637741 ATATTGAATAGGAGGGGTGAGGG - Intergenic
974937369 4:68424282-68424304 ATGTTTAATAGGAGTGGTGAGGG - Intergenic
975918548 4:79355109-79355131 ATGTTTGATAGCAGAGTAGAGGG + Intergenic
976297868 4:83489562-83489584 ATTTTAAATAGGAGGGTTAATGG + Intronic
976420563 4:84838805-84838827 ATTTTGAAAGTGAGGGTAGAAGG - Intronic
976588823 4:86828648-86828670 AATTTTATTTGGAGGGGAGAAGG - Intronic
976795430 4:88926855-88926877 ATTTTTAATAGCATGGTAGAGGG - Intronic
976874441 4:89836827-89836849 ATATTTAATAGGAAAGAAGAAGG + Intronic
976926809 4:90508570-90508592 ATTTTCAATAGGAGGACATATGG - Intronic
977181305 4:93878547-93878569 ATTTGTAATTTGAGGGAAGAGGG - Intergenic
978025252 4:103865484-103865506 ATGTTTAATAGGAGTGGTGAGGG + Intergenic
979747141 4:124230910-124230932 ATTTTGAGTGGGTGGGTAGATGG - Intergenic
980832789 4:138152053-138152075 CTTTGTAAAAGGAAGGTAGAAGG + Intergenic
982425570 4:155254629-155254651 ATTTTCAATAGGAGATTAAAAGG + Intergenic
982752165 4:159175520-159175542 AGTTTTAATAGGAGTGCTGATGG + Intronic
983384499 4:167042029-167042051 AATTCTAATAGGAGGGAAAATGG - Intronic
983805672 4:171988803-171988825 AGTTTTAATAGGATGGTAAGGGG + Intronic
988612175 5:32737111-32737133 GATTTTAATAGGAGGGGAGGAGG - Intronic
989063987 5:37441136-37441158 AATTGTAACAGGAGGGAAGAAGG + Intronic
989172138 5:38482634-38482656 ATTTGGAATATCAGGGTAGAAGG + Exonic
989235389 5:39142234-39142256 ATTTTTAATAGGTATGGAGAAGG - Intronic
992569475 5:78040491-78040513 ATGTTCAATAGAAGGGTAAAAGG - Intronic
993396939 5:87401307-87401329 TTTTTTAAGAGAAAGGTAGAAGG - Intronic
993660389 5:90626146-90626168 AATTTTTGTAGGAGGGTAGAGGG - Intronic
994417797 5:99496966-99496988 AATTGTAACAGGAGGGAAGAAGG + Intergenic
994462168 5:100078190-100078212 AATTGTAACAGGAGGGAAGAAGG - Intergenic
995078643 5:108018327-108018349 ATTTGTAATAATAGGGTAGGGGG + Intronic
995231096 5:109764484-109764506 CTTTTTAAAAGGAGGGTAAGGGG - Intronic
995806402 5:116057244-116057266 CTTTTTGAGGGGAGGGTAGAGGG + Intronic
996035270 5:118751635-118751657 ATTTTTAATAGGATATTAGTAGG - Intergenic
996429802 5:123361174-123361196 GTTTTTAACTGGAGAGTAGATGG - Intronic
998493770 5:142569247-142569269 TTTTTTAAAAGTGGGGTAGAAGG - Intergenic
998637952 5:143977419-143977441 ATCATTAATAGGATGCTAGAGGG + Intergenic
999420492 5:151437996-151438018 TTTTTTAATAGGAGGGAGGCAGG - Intronic
1000371238 5:160538645-160538667 ATGTATAATAGCAGGGCAGATGG + Intergenic
1003595069 6:7467293-7467315 TTTCTAAATAAGAGGGTAGATGG - Intergenic
1003870522 6:10399098-10399120 ATTTTGAATAGGAAGGCTGATGG - Intronic
1003940126 6:11016167-11016189 ATTTTAAAAAGGAAGGGAGAAGG - Intronic
1003973797 6:11323978-11324000 GTTTTTACCAAGAGGGTAGAGGG + Intronic
1004138005 6:12987409-12987431 ATTTGTAATAGTTAGGTAGAAGG + Intronic
1005271887 6:24174704-24174726 ATTTTTAAAAAGAGAGTATATGG - Exonic
1005499886 6:26420687-26420709 ATTTTTTTTTGGAGGGAAGAGGG + Intergenic
1008824442 6:55676346-55676368 ATTTCTCATAAGATGGTAGAGGG - Intergenic
1009622370 6:66094490-66094512 ATTTTTAACTGAAGGGTTGAAGG + Intergenic
1009789529 6:68384489-68384511 AGTTTTATGAGGAGGATAGAAGG - Intergenic
1009992853 6:70865061-70865083 ATTTTTAATCTGAGGTTAGTTGG - Intronic
1010767300 6:79790738-79790760 ATATTTAATAAGAGTGTGGATGG + Intergenic
1011184660 6:84660961-84660983 ATTTTTGAGAGGAGGGTGGGAGG + Intergenic
1012130975 6:95492314-95492336 ATTTTGAAAAGGAGGGAAAATGG - Intergenic
1014016090 6:116531800-116531822 ATTTATTATATGAGTGTAGAAGG - Intronic
1014420764 6:121242634-121242656 AATTTTAATAGGAAAATAGAAGG - Intronic
1015645160 6:135379595-135379617 TTTTTAAATAGGTAGGTAGATGG - Intronic
1015754246 6:136591705-136591727 ATATTTAAAAGGAGGGTGAAGGG - Intronic
1015943983 6:138481017-138481039 ATTATTAATAACAGGGTAAAAGG + Intronic
1016064495 6:139665163-139665185 ATTTTTGATAGGAATGTAAATGG - Intergenic
1016395534 6:143619789-143619811 ATTTTTAATAAGGGGATAAAAGG + Intronic
1018312736 6:162527720-162527742 ATTTTTAAAAGGAGTGAGGAGGG + Intronic
1021207702 7:17805855-17805877 ATTTGTATTAGGAGGGAAGTGGG + Intronic
1022749476 7:33208734-33208756 GTTTTTTCTAGGAGGGTAGGGGG + Intronic
1022916062 7:34954206-34954228 ATTTTTGGTATTAGGGTAGAAGG - Intronic
1023777193 7:43618963-43618985 ATATTTAAAAGGAGGACAGAAGG + Intronic
1025274718 7:57568858-57568880 ATTTTTAATAAAAGGATAAAAGG - Intergenic
1027271092 7:76519345-76519367 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027320855 7:77009280-77009302 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027748155 7:82105325-82105347 ATTTGTGATAGAAGGGTAAATGG - Intronic
1028065917 7:86383732-86383754 AGTTTGAATAGGTGGGTGGAAGG - Intergenic
1028233962 7:88337798-88337820 ATTTTTAAAATGAGGTTAGTTGG - Intergenic
1029352609 7:100025139-100025161 ATTTTTAATAGGAAAGTATTGGG + Intronic
1029682452 7:102121080-102121102 ATTTTTAAAAGGAGGGGAGGAGG + Intronic
1030782275 7:113616234-113616256 TTTTTTAATAGTATGGTAGCAGG + Intergenic
1031001730 7:116423444-116423466 ATATTTAATAAGAGGATTGAAGG + Intronic
1031680874 7:124673190-124673212 GTTTTTAAGAAAAGGGTAGAAGG - Intergenic
1032866669 7:135932571-135932593 ATTTAGAATAGAAGAGTAGAAGG - Intronic
1033200240 7:139361927-139361949 AGTTTTACTGGGAGGGTAGTTGG + Intronic
1034312586 7:150101944-150101966 AGCTTTAATAGGAGGATAAAGGG + Intergenic
1034794270 7:153998717-153998739 AGCTTTAATAGGAGGATAAAGGG - Intronic
1035943198 8:3927872-3927894 ATTCTTAATATGAGAGTCGAAGG + Intronic
1037551403 8:19975200-19975222 ATTTTTAAAAGAAAAGTAGATGG - Intergenic
1038705159 8:29886590-29886612 AATTTGAATAAGAGGGGAGAGGG - Intergenic
1039041830 8:33415672-33415694 ACTATAAATAGGAGGATAGAGGG + Intronic
1039345561 8:36701432-36701454 ATTTTTAAAGAGAGGGTAAAAGG - Intergenic
1039750692 8:40475584-40475606 ATTTTTAAAAGAAGGGTGGGGGG + Intergenic
1041307903 8:56482407-56482429 ATTTTTAATAGATGAATAGATGG - Intergenic
1043613963 8:82102620-82102642 ATTTAGAATAGGAGGGTTGGAGG + Intergenic
1043678454 8:82991755-82991777 AATTTTAGTAGCATGGTAGAAGG + Intergenic
1043773464 8:84234655-84234677 ATGTTTAAAAGGTGGGCAGATGG - Intronic
1045056059 8:98369434-98369456 ATTTTTAATACGGGGGTTCAGGG + Intergenic
1045156839 8:99485733-99485755 ATTATTACTAGGAGGAGAGAAGG + Intronic
1046355837 8:113083722-113083744 ATTTTCAATTGAAAGGTAGAGGG + Intronic
1046965870 8:120165090-120165112 ATTTTTATTGGCAGGATAGAGGG + Intronic
1048559786 8:135521628-135521650 ATTTGTAATATGAGGTTGGATGG + Intronic
1048740664 8:137556360-137556382 ATTTTTAATAAAATGGCAGAAGG + Intergenic
1051012907 9:12439905-12439927 ATTTTTAAATGCAGGGCAGATGG + Intergenic
1052165828 9:25326798-25326820 ATCTTAATTAGGAGGGTAGTTGG - Intergenic
1052602225 9:30648647-30648669 ATTTTTATTAGAAGGCTTGAAGG - Intergenic
1053273692 9:36767369-36767391 TTTTATAATAGGAGTTTAGATGG + Intergenic
1054970808 9:71084064-71084086 ATTTTTGAAAGAAGGGAAGAAGG + Intronic
1055036910 9:71827312-71827334 ATTATTAATAGGAGAATAGCTGG - Intergenic
1055467208 9:76577516-76577538 ATTTCTAAAATGAGGGTAAATGG + Intergenic
1056583955 9:87916095-87916117 ATTACTAATAGGAGGGTATCTGG + Intergenic
1057251470 9:93506910-93506932 ATTTTTAATAGAAGGTGCGATGG + Intronic
1060042530 9:120311637-120311659 ATTTCTAAAACGAGGGTAAACGG - Intergenic
1060078198 9:120614701-120614723 ATTTTTAATAGGGGGAGAGTAGG - Intronic
1060465524 9:123901381-123901403 ATTTTTAATAGGAGGGTAGAGGG - Intronic
1061583185 9:131550007-131550029 AGTTTTAATAGGATGGTAAGGGG - Intergenic
1186725300 X:12351316-12351338 ATTTTTAATGGGGGGGCAGGGGG - Intronic
1187166103 X:16805280-16805302 ATTTTTAAAAAGGGGGTGGAGGG - Intronic
1187780677 X:22819210-22819232 ATTTTTTATGACAGGGTAGAGGG + Intergenic
1188004935 X:25010746-25010768 ATTTTTAAAAAGAAGGCAGAAGG - Intronic
1191657131 X:63610607-63610629 ATTTTGAATAGGAGTGGTGAGGG - Intergenic
1192463038 X:71334167-71334189 ATATTTAATAGGAGTGGTGAAGG + Intergenic
1192573539 X:72225096-72225118 ATTTGCAATAGGAGGGTGTAGGG - Intronic
1195135535 X:101903942-101903964 ATATTTAATACAAGGGTGGATGG + Intronic
1195462202 X:105140184-105140206 AGTTCTAATAGGAAGGTAAAAGG - Intronic
1195511283 X:105718221-105718243 ATTCTTAATGGGAGTGAAGAGGG - Intronic
1196805676 X:119583402-119583424 ATGTTTAAGGAGAGGGTAGAAGG - Exonic
1198152185 X:133922204-133922226 CTTTTTAAGAGAAGGCTAGAGGG + Intronic
1198968703 X:142255176-142255198 ATTTTTTCTAGGAAGGTAAATGG + Intergenic
1199199017 X:145065942-145065964 TTTTTTAATTGGAGTGGAGAGGG + Intergenic
1200308193 X:155050121-155050143 ATATTTAATAGGAGTGGAGACGG + Intronic
1200711560 Y:6489343-6489365 ATTTTTAATAGGAGGGCTAGGGG - Intergenic
1201022374 Y:9672636-9672658 ATTTTTAATAGGAGGGCTAGGGG + Intergenic