ID: 1060466629

View in Genome Browser
Species Human (GRCh38)
Location 9:123912697-123912719
Sequence CTCCACTGAAACCACACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060466629_1060466632 1 Left 1060466629 9:123912697-123912719 CCATCAGTGTGGTTTCAGTGGAG 0: 1
1: 0
2: 4
3: 24
4: 204
Right 1060466632 9:123912721-123912743 CCCTGGACTTCCACCGCCTCTGG No data
1060466629_1060466635 12 Left 1060466629 9:123912697-123912719 CCATCAGTGTGGTTTCAGTGGAG 0: 1
1: 0
2: 4
3: 24
4: 204
Right 1060466635 9:123912732-123912754 CACCGCCTCTGGCAGTAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060466629 Original CRISPR CTCCACTGAAACCACACTGA TGG (reversed) Intronic
900675127 1:3880675-3880697 CTCCACCAGAGCCACACTGAAGG - Intronic
901432191 1:9223149-9223171 TTCCACAGAAACCACAATCAGGG + Intergenic
901582115 1:10253048-10253070 CCCCACTAAAATCACACTGTAGG - Intronic
904421916 1:30399493-30399515 GTGCACTGAACCCTCACTGAGGG - Intergenic
905999552 1:42412490-42412512 GTACAGTGAAACCAAACTGATGG + Intronic
907175705 1:52520359-52520381 CTATACTGAAAACACAATGAAGG + Intronic
908274928 1:62460547-62460569 ATCCACAGAAGGCACACTGATGG + Intronic
909267293 1:73577062-73577084 CTTCCCTGAAACCACAGTGCAGG + Intergenic
909768349 1:79386972-79386994 CTCCACTGAAGCTATACTGATGG - Intergenic
915374919 1:155385825-155385847 CTCCACTGAAACCTGAGTGTTGG + Intronic
916213956 1:162380395-162380417 CACCACTGAAACCACAAGAAAGG + Intronic
916645680 1:166782900-166782922 CCCCACTGAAAAGACACAGACGG - Intergenic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
917705077 1:177624285-177624307 CTCGACTGACACCACATTGGGGG - Intergenic
919453966 1:197801420-197801442 CTCCAGTGAAACCCCACCCAGGG + Intergenic
919649680 1:200134969-200134991 CTCCACAGAAAACAGAATGACGG - Intronic
919836526 1:201578480-201578502 CTCCTCTTATACCACACTGTGGG + Intergenic
920655769 1:207873506-207873528 AACCACTGTAACCACACTCAGGG - Intergenic
920656775 1:207882353-207882375 CTCCTTTGATACCACACTGGTGG - Intergenic
921767554 1:218990232-218990254 CACCACTGCAAACACCCTGATGG - Intergenic
924118891 1:240776456-240776478 CCCCACTGCAAACAGACTGATGG + Intronic
924310815 1:242741513-242741535 CTCCACTGATACTATCCTGATGG + Intergenic
1063814353 10:9755836-9755858 CTGCACTGAAGCCACATTTAGGG - Intergenic
1063878351 10:10505358-10505380 CTCCACTGACACCATGGTGAGGG + Intergenic
1064992445 10:21267638-21267660 TTCCATTGAGACCACACTGTCGG - Intergenic
1065318380 10:24486189-24486211 CTCCACTGAGAACAGGCTGAAGG - Intronic
1065738346 10:28774096-28774118 ATCCAATGAAACCACAGTGCTGG + Intergenic
1067076753 10:43191893-43191915 CTCCACCCAAACCCCACCGAGGG - Intergenic
1069124963 10:64618994-64619016 CTCTACAGACACCACAGTGAGGG - Intergenic
1076834029 10:133012027-133012049 CTCCCTTCAAACCACACTGTAGG + Intergenic
1077237653 11:1489547-1489569 CTGCACGCAGACCACACTGAAGG + Intronic
1078110922 11:8391333-8391355 CCCCAAGGAAAGCACACTGAAGG + Intergenic
1081334730 11:41850508-41850530 CTCCATTGCAGCCACAGTGATGG + Intergenic
1083402557 11:62434095-62434117 CCGCACAGAAACCACACAGAGGG - Intronic
1086237582 11:84650273-84650295 CTCCACTGAAACCACCCATGTGG + Intronic
1086609228 11:88734198-88734220 CTCCAAAGAAAGCACACTAATGG + Intronic
1086848698 11:91783238-91783260 CTGCTCTGAAGCCACAATGAGGG + Intergenic
1086989333 11:93286307-93286329 CTCCCCTGCAACCACCCTCATGG + Intergenic
1087744626 11:101929523-101929545 CTCCATTGATACCACAGTGGAGG + Intronic
1090156981 11:124448731-124448753 CTACACAGAAACCACACTATTGG + Intergenic
1090517212 11:127441755-127441777 CTCCACTGATATCACAATGGAGG - Intergenic
1091339181 11:134796972-134796994 CTCCACTGATACCATCCCGATGG + Intergenic
1092043370 12:5405207-5405229 TTGAACTGAAACCATACTGAGGG + Intergenic
1094016189 12:25866908-25866930 CTCCACTGACACCACCCCAATGG - Intergenic
1094053515 12:26245653-26245675 TTCCACTGCAAACTCACTGAAGG - Intronic
1095277564 12:40306196-40306218 CTCCACTGAAAAGAAACAGAAGG - Intronic
1095710028 12:45278288-45278310 CACGACTGAAAACAAACTGAAGG - Intronic
1095997708 12:48103287-48103309 CTTCCCTGAAATCACACAGATGG + Intronic
1097540587 12:60937167-60937189 TTCCACTGAAACCCCAGTGAAGG + Intergenic
1099304821 12:80940028-80940050 CTTCACTGACACCACAATCAGGG - Intronic
1099772594 12:87081192-87081214 CTCTACTGAAACCACCATGCTGG - Intergenic
1099854141 12:88142402-88142424 CGCCACTGAAACCACAGTCATGG - Exonic
1100613941 12:96216241-96216263 CTCCAGAGAAACCACATAGATGG + Intronic
1101129167 12:101671402-101671424 CTCCCATGAAACCAAACTAAAGG + Intronic
1102071276 12:110021975-110021997 CTCCACTGAGACCACACCAAAGG - Intronic
1102103984 12:110304565-110304587 CTCCAAAGAAAACACACCGATGG - Intronic
1102415525 12:112759294-112759316 CACCACTGAAAACACACAGAAGG + Intronic
1103834609 12:123808845-123808867 CCACACTGAAACCATTCTGACGG + Exonic
1104012746 12:124943477-124943499 CTCCACTCACACCACACCCAAGG - Intergenic
1107981426 13:45737708-45737730 CCCCACAGAAACCACAATAAAGG - Intergenic
1109011151 13:56946403-56946425 GTCCTCTGAAACCTCACTGATGG + Intergenic
1109833709 13:67827441-67827463 CTCCACTGATTCCACAGTGGGGG + Intergenic
1110904836 13:80873741-80873763 TTCCACTGACACCACAGAGAGGG - Intergenic
1113685533 13:112280111-112280133 CTTCCCTGAATCCACCCTGAAGG - Intergenic
1113686662 13:112286500-112286522 CTTCCCTGAATCCACCCTGAAGG - Intergenic
1116084026 14:40212256-40212278 TTCCACTGACATCACACTTATGG - Intergenic
1117498374 14:56328309-56328331 TTCCAGTGAAGCCACAGTGATGG + Intergenic
1118235721 14:64003626-64003648 CTCCACAGTAAACACACAGAAGG - Intronic
1118537442 14:66783432-66783454 CTCCACTGACACTACCCTGCTGG - Intronic
1119339798 14:73867256-73867278 ATTCACTGGAACCACACTGCTGG + Intronic
1120476962 14:85000270-85000292 CTCTACTTAAACCATACTGAGGG - Intergenic
1121034098 14:90684923-90684945 CTTCACAGAAACCACCCAGAAGG + Intronic
1121422869 14:93827870-93827892 GTCCATTGCAACCACACAGAAGG + Intergenic
1124118794 15:26870507-26870529 GTGCACTCTAACCACACTGACGG + Intronic
1127359294 15:58230795-58230817 CTGCCCTGAACACACACTGAAGG + Intronic
1127359327 15:58230976-58230998 CTGCCCTGAATACACACTGAGGG + Intronic
1127413540 15:58733321-58733343 CCACACTGAAACCACTCTGAGGG - Intronic
1128349150 15:66877590-66877612 CTCCTCTTAAACCACATTCATGG + Intergenic
1130694689 15:86119153-86119175 CTCAACTTAAACCACACTCTGGG + Intergenic
1133373316 16:5262880-5262902 CTCCATTGTAACTCCACTGAAGG + Intergenic
1133719160 16:8478371-8478393 CTCCACGGTTATCACACTGATGG + Intergenic
1135385465 16:22035572-22035594 CTCCACAGAAACCTGAATGAAGG - Intronic
1137394147 16:48105174-48105196 CTTCACCAAGACCACACTGATGG - Exonic
1137641879 16:50039348-50039370 CTTAACTGAAAACACTCTGATGG - Intergenic
1138508684 16:57494562-57494584 CTCCACTGATACCACTGTGGAGG + Intergenic
1138925480 16:61585179-61585201 TTCCAAAGAAACCACAGTGAAGG - Intergenic
1141160802 16:81628072-81628094 CTCCCCTGACCCCTCACTGAGGG + Intronic
1141276094 16:82589529-82589551 CTCCAGTGAAGCCCCAGTGAAGG - Intergenic
1142496736 17:310004-310026 CTCCCCTGCACCCACACTGTGGG + Intronic
1144602520 17:16629943-16629965 CTCCACTAAAACTTCACTTATGG - Intronic
1145722219 17:27083695-27083717 CTCCACATGAGCCACACTGATGG + Intergenic
1147412891 17:40266476-40266498 CTCCACTGAAACTACTCAAAAGG - Intronic
1149636043 17:58170219-58170241 CTGCACTGACACCTCACTGCTGG + Exonic
1151853394 17:76705008-76705030 CTCGGCTCAAACCACACTGTGGG - Intronic
1153756553 18:8289130-8289152 CTCCCCTGAAATCACACAGCTGG - Intronic
1155315680 18:24568134-24568156 TTCCACAGAAACCACAATAAGGG - Intergenic
1156235925 18:35204680-35204702 CTCCTATGAATCCACACTGGTGG - Intergenic
1156621625 18:38858114-38858136 CTCCACTGATACCACAATAAAGG - Intergenic
1157511664 18:48279690-48279712 CCCCACTGAAGCCTCACTGGTGG + Intronic
1163856564 19:19707115-19707137 TTCCACTGAGAGCACAATGAGGG + Intergenic
1164536394 19:29089114-29089136 CTGCACAGAAACAACACTCAAGG - Intergenic
1167048572 19:47065830-47065852 CTGCACTGAAAAGACAGTGATGG + Exonic
1167429919 19:49448257-49448279 CTCTAGTGACATCACACTGATGG - Intronic
924963295 2:54184-54206 CTCAACTGAAACCACACCATGGG - Intergenic
927441379 2:23120346-23120368 CACCACTGAAACCACAGTGCTGG - Intergenic
927806776 2:26154877-26154899 CTCCACAGAAAACATACAGATGG + Intergenic
928976021 2:37087263-37087285 CTCCACTAAAACCACATGAAGGG + Intronic
929046626 2:37796920-37796942 CTCAACTGAATCCAAGCTGAAGG + Intergenic
929991778 2:46796447-46796469 CTCCACTGAAACCTCACCACTGG + Intergenic
930410424 2:51018328-51018350 ATGCACTGACACCACACTGCAGG - Intronic
930581382 2:53216618-53216640 CCCCACAAAAACCTCACTGAAGG - Intergenic
932274536 2:70442257-70442279 CTTAACTGGAACCACACTTAAGG + Intergenic
932662921 2:73672659-73672681 CTGCAGTGAAACCAAACTCAAGG + Intergenic
932668505 2:73717421-73717443 CTGCAGTGAAACCAGACTCAAGG + Intergenic
935171659 2:100614956-100614978 CTCCACTGAGGGCACATTGAGGG - Intergenic
936276877 2:111106837-111106859 CTCCACTGACATCTCACTGATGG + Intronic
938655170 2:133424112-133424134 CTCTACTGAAACTAAAGTGATGG + Intronic
947874143 2:233457436-233457458 CTCCACGGCAACCCCACTGCTGG - Intronic
1169179981 20:3555321-3555343 CCCCACAGAAACCACACTCGGGG + Intronic
1169325688 20:4673667-4673689 TCCCACTGAAACCCCAATGAAGG - Intergenic
1170596813 20:17811691-17811713 CACCAGTGCCACCACACTGAAGG - Intergenic
1172173428 20:32958509-32958531 CTCCACTGGCACCACCCAGAAGG + Intronic
1172800624 20:37573838-37573860 CCCGGCTGAAAGCACACTGATGG - Intergenic
1174852522 20:54008443-54008465 CTTCACTGATACCACAGTGGAGG - Intronic
1175335298 20:58192179-58192201 CTTCACTGATACCACTCTGTGGG + Intergenic
1177200480 21:17949088-17949110 CACCACTAACACCACACTCAGGG - Intronic
1178014290 21:28325735-28325757 CTCCACTGACACCATAGGGAGGG + Intergenic
1178022289 21:28422873-28422895 GGACACAGAAACCACACTGAAGG + Intergenic
1179127278 21:38601257-38601279 CCCCACTGAATCCCAACTGAAGG + Intronic
1179250265 21:39666078-39666100 CTCAAGTGAAACCACAGTGTTGG - Exonic
1179632788 21:42688955-42688977 GTCCACTGAGACCTCACTGAGGG - Intronic
1179632836 21:42689147-42689169 GCCCACTGAAGCCTCACTGAGGG - Intronic
1182317425 22:29457331-29457353 CTCCTCTGATCCCACCCTGAAGG + Intergenic
950285716 3:11743206-11743228 CTCCACTGCCACCACTCTGCTGG - Intergenic
951039578 3:17974382-17974404 CTCCACTGTAACCAGGCAGAGGG + Intronic
951155458 3:19347927-19347949 CTCCACTGCAATGTCACTGACGG - Exonic
953544891 3:43857092-43857114 TCCCACTGACACCCCACTGAGGG - Intergenic
956729514 3:72184053-72184075 GTCCACTGGATCTACACTGATGG - Intergenic
958478029 3:94610045-94610067 CTCTAATGACACCACACAGACGG - Intergenic
959946198 3:112127963-112127985 CCACATTGAAACCACACTTAGGG + Intronic
961483177 3:127196980-127197002 CTCCAATACAGCCACACTGAAGG - Exonic
961561842 3:127735760-127735782 CTCCTCTGAAACCATACAAAGGG - Intronic
961733551 3:128985614-128985636 CTCCAGTGAAAGCCCACTGCAGG + Intronic
963712948 3:148768232-148768254 CTCCAATGATACCACAGTGGAGG - Intergenic
965455476 3:168894533-168894555 CTCCTCTGATACCACCCAGAAGG - Intergenic
966980948 3:185134840-185134862 CTCCACTGATACCACCATGGGGG - Intronic
968720244 4:2197215-2197237 CTGCACAGAAAACAGACTGAAGG + Intronic
971350661 4:25853024-25853046 CAAAACTGAAACCACACTCAGGG - Intronic
974611229 4:64219833-64219855 TCACTCTGAAACCACACTGAGGG + Intergenic
979667565 4:123328932-123328954 CTCCACTGAATCACCAGTGAAGG - Intergenic
980559607 4:134455717-134455739 CTCCACAGAACAAACACTGATGG - Intergenic
981105023 4:140870870-140870892 TTCCACAAAAACCACAGTGAAGG - Intronic
984041524 4:174740348-174740370 CCCCAGAGAAACTACACTGAAGG + Intronic
984207387 4:176801277-176801299 CTCCACTGAAATCATACTCAAGG + Intergenic
985035199 4:185831704-185831726 CTCCACTGTAAGCTCCCTGAGGG - Intronic
987350660 5:17018916-17018938 CTCCACTATAAACTCACTGAGGG - Intergenic
987425870 5:17772313-17772335 CTCCACTGATACCACAGAGTGGG + Intergenic
988906405 5:35795014-35795036 TTCCACTGAAACAACATTGTGGG - Intronic
989551646 5:42742696-42742718 ATACACTGATACCACACTCAAGG - Intergenic
991319836 5:65360135-65360157 CTCCTCAGAAACCAAACAGATGG - Intronic
991358741 5:65797845-65797867 CTTCACTCAAAACCCACTGAAGG - Intronic
992098627 5:73384016-73384038 TTCTTCTGAAACCAAACTGAGGG + Intergenic
992177416 5:74164079-74164101 CTCCACTGAAATCACGTTGGTGG + Intergenic
993004097 5:82412458-82412480 CTCCTCTGATACCTCACTGCAGG + Intergenic
996020851 5:118589325-118589347 TTCCACAGAAACCACAATAATGG + Intergenic
998054285 5:139061234-139061256 CTCCACAGCAACCTCACTGTGGG - Intronic
998532236 5:142895999-142896021 CTTGACTGAAACCACACTGCTGG - Intronic
999145679 5:149391702-149391724 CTCCACTGACAGCTCAGTGACGG - Intronic
999628335 5:153543862-153543884 CTCGACTGAAAGCTCACTGAGGG - Intronic
1001439429 5:171728781-171728803 CTTAACTGTAACCACACAGATGG + Intergenic
1002370804 5:178752631-178752653 CTCCACTAAAATGATACTGAAGG + Intergenic
1002374720 5:178780537-178780559 CACCACTCAAACCACACTCAGGG + Intergenic
1003522970 6:6874261-6874283 CTCAAATGAAACCACACTGGAGG + Intergenic
1004207533 6:13606258-13606280 CTCCACTCCAGCCACACTGAGGG - Intronic
1004516368 6:16325534-16325556 CTCCCATGAAACCACAATAAAGG + Intronic
1008168496 6:48170856-48170878 CTCCTCTGAGACCACCCTAAAGG - Intergenic
1008552270 6:52644485-52644507 CTCCACAAAAACCACAGGGATGG - Intergenic
1014782223 6:125577346-125577368 CTCCACTGCTACCACTCTGGTGG - Intergenic
1016594962 6:145788722-145788744 CTCCACTGGAAACACCCTCATGG - Intergenic
1016874266 6:148849164-148849186 CTCCTCTGAAAACACTCTCAAGG + Intronic
1018726683 6:166618183-166618205 CTGCACAGAAAGCACATTGAAGG - Intronic
1018907490 6:168083973-168083995 CTCTACTGAAGCCTCACTGCAGG + Intergenic
1020528647 7:9299242-9299264 CATCACGGAAACCACACTCATGG - Intergenic
1021114999 7:16737600-16737622 CTCCACTGAAACCAGTATGTAGG - Intergenic
1021242043 7:18214854-18214876 GTCCACTCAAAGCAAACTGATGG + Intronic
1022977906 7:35575473-35575495 CTGCAGTGAAACCTCACTTAAGG + Intergenic
1023258914 7:38338985-38339007 CTTCACAGAAACCCCATTGAGGG - Intergenic
1024053140 7:45642198-45642220 TTACCCTGAAACCACAATGAAGG - Intronic
1024137529 7:46426014-46426036 CTCCACTGAGACCACTCAGGGGG - Intergenic
1024715107 7:52070309-52070331 CTCCTCATAAACCACAGTGATGG + Intergenic
1025950575 7:66142181-66142203 TTCCACTGAGACCACGGTGAGGG - Intronic
1026827159 7:73591611-73591633 ATCCACTGGAACCACCCAGAAGG - Intergenic
1028272334 7:88808026-88808048 CTCAAATGACACCACATTGAAGG + Intronic
1032368931 7:131327457-131327479 CTTTACGGAAACAACACTGAAGG - Intronic
1032955564 7:136967793-136967815 CTCCACTGAAACTACAATTAGGG + Intronic
1034292585 7:149944842-149944864 CTCCACAGAAACCACACTGTTGG - Intergenic
1034813484 7:154152050-154152072 CTCCACAGAAACCACACTGTTGG + Intronic
1035246903 7:157568519-157568541 CTGCACTGCAACAACACTGAAGG + Intronic
1037063504 8:14546162-14546184 ATCCACACACACCACACTGAGGG + Intronic
1038321187 8:26528806-26528828 CTTCCCTGAAACCACAATAAAGG - Intronic
1038729907 8:30117467-30117489 GTACAATGAAACCAAACTGAAGG + Intronic
1040534600 8:48297685-48297707 GTCCACTGACACCACCCTGGTGG + Intergenic
1040975594 8:53190961-53190983 TTCCACTGCACCCACACCGAGGG + Intergenic
1041138327 8:54785816-54785838 CTCCAGTGAAAACACACCAATGG - Intergenic
1041153565 8:54961053-54961075 CTCCAGTGAGGGCACACTGAAGG - Intergenic
1041834499 8:62196522-62196544 CTCCACAGATACCTCATTGATGG - Intergenic
1042178915 8:66065340-66065362 CCCCACTGAGGACACACTGAAGG - Intronic
1048613286 8:136047644-136047666 CTCCACTGTAAACACCTTGAAGG + Intergenic
1049642533 8:143722022-143722044 CTCCACTGCACCCCCTCTGATGG + Intronic
1051468933 9:17412236-17412258 CTCATCTGACACCACACTGATGG - Intronic
1051516492 9:17935822-17935844 CTCTACTGAGACGAGACTGAAGG - Intergenic
1051904517 9:22079921-22079943 CTCTACCGAAACCACACCAAAGG - Intergenic
1052686941 9:31768980-31769002 CTCCTCTGACACCATTCTGATGG - Intergenic
1052835407 9:33246481-33246503 CTTCACTGGACCCACACTGGGGG + Intronic
1054880791 9:70142616-70142638 CTCACCAGAAACCACCCTGATGG - Intronic
1055376465 9:75654023-75654045 CTCCACTGAAAACACACTGCAGG - Intergenic
1055558817 9:77502512-77502534 CTCCACTGAGACCTCCCTGCTGG + Intronic
1058124565 9:101176567-101176589 CTCCACTGATACCACCCTGGTGG - Intronic
1059389676 9:113991075-113991097 CCCCACTGAATCCAGACTGCTGG - Intronic
1060466629 9:123912697-123912719 CTCCACTGAAACCACACTGATGG - Intronic
1187353297 X:18542299-18542321 CTCCACTGACACCAGCCTGGCGG + Intronic
1187475563 X:19607907-19607929 CTCCGCTGAAATCAAAGTGAAGG + Intronic
1189963134 X:46344276-46344298 CCCCACTGACACTACACTGTGGG - Intergenic
1189991018 X:46595382-46595404 CTCCACTGACACCACACTGGTGG + Intronic
1190447786 X:50546890-50546912 CTCCTCTGACACCACTCTGTAGG - Intergenic
1192057223 X:67785240-67785262 CTCCAATGAAATCTCATTGATGG - Intergenic
1195808093 X:108798175-108798197 CTCCACAGAAACCAGTCTGGGGG - Intergenic
1196251934 X:113470951-113470973 CTCCAGAGAAATCACAATGATGG + Intergenic
1197178464 X:123509456-123509478 CTTCACTGCAAACACAGTGATGG + Intergenic
1197322156 X:125045688-125045710 CTGCACTGAAGTCACAATGATGG - Intergenic
1198050557 X:132948921-132948943 CTCCACTGAAACTACACCGTAGG - Intronic
1200066219 X:153505263-153505285 CTCCCCTGACACCACGCTGCTGG + Exonic
1200270492 X:154678078-154678100 GTCCACTAAAAACACACTGATGG - Exonic