ID: 1060468671

View in Genome Browser
Species Human (GRCh38)
Location 9:123929957-123929979
Sequence GCCGGTCGGCCGCGGGCGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 324}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060468671_1060468685 20 Left 1060468671 9:123929957-123929979 CCGCCCGCCCGCGGCCGACCGGC 0: 1
1: 0
2: 4
3: 37
4: 324
Right 1060468685 9:123930000-123930022 GCCCCTTCCTCCCTTCCCTCAGG 0: 1
1: 0
2: 9
3: 112
4: 742
1060468671_1060468689 24 Left 1060468671 9:123929957-123929979 CCGCCCGCCCGCGGCCGACCGGC 0: 1
1: 0
2: 4
3: 37
4: 324
Right 1060468689 9:123930004-123930026 CTTCCTCCCTTCCCTCAGGCTGG 0: 1
1: 1
2: 5
3: 71
4: 639
1060468671_1060468690 25 Left 1060468671 9:123929957-123929979 CCGCCCGCCCGCGGCCGACCGGC 0: 1
1: 0
2: 4
3: 37
4: 324
Right 1060468690 9:123930005-123930027 TTCCTCCCTTCCCTCAGGCTGGG 0: 1
1: 0
2: 2
3: 43
4: 459
1060468671_1060468691 26 Left 1060468671 9:123929957-123929979 CCGCCCGCCCGCGGCCGACCGGC 0: 1
1: 0
2: 4
3: 37
4: 324
Right 1060468691 9:123930006-123930028 TCCTCCCTTCCCTCAGGCTGGGG 0: 1
1: 0
2: 9
3: 80
4: 676

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060468671 Original CRISPR GCCGGTCGGCCGCGGGCGGG CGG (reversed) Exonic
900159632 1:1217390-1217412 GTCGGTCGGCCGGTGGCGGGCGG + Exonic
900203154 1:1420235-1420257 ACTGGGCGGCCGCGGGCGGGCGG - Exonic
901022196 1:6261088-6261110 GCCGGGCGGCCGGGGGCGGGGGG + Intergenic
901086617 1:6614887-6614909 GTCCGGCGACCGCGGGCGGGTGG + Intronic
901243002 1:7705503-7705525 GCGTGTCGGGCGCGCGCGGGCGG + Intronic
901660300 1:10794882-10794904 GCCGGGCGCGGGCGGGCGGGCGG - Intronic
901660302 1:10794886-10794908 GCTGGCCGGGCGCGGGCGGGCGG - Intronic
901810015 1:11762200-11762222 GTCGGCAGGTCGCGGGCGGGAGG - Exonic
902955145 1:19920418-19920440 GCAGGTCAGCCGCTGGCAGGTGG + Exonic
904620464 1:31772062-31772084 GCCGCGCGGCCGGGAGCGGGCGG + Intergenic
904696950 1:32336171-32336193 GCGGGTCGGCCGCGGAGCGGAGG - Exonic
904775129 1:32901547-32901569 GCCGGTGGGCTGAGGGAGGGCGG - Intergenic
905179144 1:36155994-36156016 GCCGGGAGGCTGCGGGCGCGGGG + Intronic
905379856 1:37554090-37554112 TCCGGACGGCGGTGGGCGGGAGG + Exonic
906794652 1:48687381-48687403 CCCGGTGGGCCGCGGGTGGGCGG + Intronic
907429928 1:54405898-54405920 GCCGCCGGGCTGCGGGCGGGCGG - Intronic
910163399 1:84298429-84298451 GCCGGTCGGCGGGGGTCGGAGGG - Exonic
912309928 1:108609897-108609919 GCCTGTCGGGAGGGGGCGGGAGG + Intronic
912492617 1:110070463-110070485 GCGGGTCAGCCGCGGGCCGCGGG + Exonic
913592528 1:120342304-120342326 GAGGGTCCGCGGCGGGCGGGTGG - Intergenic
913650822 1:120912826-120912848 GAGGGTCCGCGGCGGGCGGGTGG + Intergenic
914170290 1:145216241-145216263 GAGGGTCCGCGGCGGGCGGGTGG - Intergenic
914525408 1:148460207-148460229 GAGGGTCCGCGGCGGGCGGGTGG - Intergenic
914598266 1:149175623-149175645 GAGGGTCCGCGGCGGGCGGGTGG + Intergenic
914640993 1:149606921-149606943 GAGGGTCCGCGGCGGGCGGGTGG + Intergenic
915161384 1:153922870-153922892 GCCGGACCGGGGCGGGCGGGCGG + Exonic
915916315 1:159943062-159943084 GCCGGCCGGCCGGGGGCAGCAGG + Exonic
915932803 1:160070288-160070310 GCCGGGCAGGCGGGGGCGGGGGG + Intergenic
916694420 1:167221408-167221430 GGCGGGCGGCCGGGGCCGGGCGG + Intronic
916694429 1:167221422-167221444 GCCGGGCGGGCGCGGGGTGGGGG + Intronic
918066400 1:181104991-181105013 GCCGGTGGGCTGGGGGCGGCAGG - Intergenic
919810376 1:201405520-201405542 GCTGGGCAGCCGGGGGCGGGGGG - Exonic
920013665 1:202888639-202888661 GCCGGTGCTCCGCGGGCGCGTGG - Intronic
920912943 1:210234124-210234146 CCCGGTCGGCCGCTGGCCGCAGG - Intronic
921909086 1:220528299-220528321 GCCGCTGGGCCCCGGGCGCGTGG + Intronic
922757201 1:228103011-228103033 GCCGGTAGGCCGCTGGCAGAAGG - Exonic
922851318 1:228735847-228735869 GCCGGGGGGCCGGGGGCGTGCGG + Exonic
1063639778 10:7818372-7818394 GCCGGCCGGAAGCGGGCGTGGGG - Intergenic
1064274232 10:13891875-13891897 GCGGGCCGGGCGCGGGCGAGGGG - Intronic
1065188926 10:23193235-23193257 GCCGGGCGGCGGCGGGCGCCTGG + Exonic
1067342947 10:45419234-45419256 GCCGGGCGAGCGCAGGCGGGCGG + Intronic
1067769842 10:49115368-49115390 GCCGGGCGGCCGCGCCGGGGAGG - Intronic
1070140199 10:73733027-73733049 GCCGTTGGGCCGCCGGCCGGGGG - Intergenic
1070257636 10:74825532-74825554 GGCGGTGGGTCCCGGGCGGGGGG + Intergenic
1072089636 10:92115041-92115063 CCCCGGCGGCCGCGGGCGCGGGG + Intronic
1072731546 10:97850132-97850154 TCAGGTGGGCCGGGGGCGGGCGG - Intergenic
1072783984 10:98268227-98268249 GCTGGGGGGCCGCGGGCGGGAGG - Exonic
1073403527 10:103277412-103277434 GCCCGTCGGACGCCGGCGGCCGG - Exonic
1073441443 10:103555172-103555194 GCCGGCTGGCCGCGGGCGGGCGG + Intronic
1073465636 10:103693237-103693259 GCAGGGGGCCCGCGGGCGGGCGG - Intronic
1074399082 10:113126887-113126909 CGCGGCCGGCGGCGGGCGGGCGG + Intronic
1075040632 10:119104396-119104418 CACAGGCGGCCGCGGGCGGGCGG - Intronic
1075645061 10:124091901-124091923 GCCGGCCGGCCCCGGGCGCAGGG + Intronic
1075698022 10:124449944-124449966 GCCCGTCGCCCACGGGCCGGCGG + Exonic
1076683176 10:132185754-132185776 GCCGGGCGGCAGGAGGCGGGGGG + Intergenic
1076710552 10:132331693-132331715 GCCGGAGGGCCCGGGGCGGGCGG - Intronic
1077076922 11:706187-706209 CCAGGTCTCCCGCGGGCGGGTGG - Exonic
1077442492 11:2575167-2575189 GCCGCTCTGCTGCGGGCTGGGGG - Intronic
1078317724 11:10306318-10306340 TCCGGACTGCTGCGGGCGGGGGG - Exonic
1078561700 11:12377996-12378018 CCCGGGCGACCGCGAGCGGGCGG - Intronic
1078771873 11:14358951-14358973 GCCGGCGGGCTGCGGGCGAGCGG + Exonic
1081528392 11:43942455-43942477 GCCGGTTGGCGGGGGGCGGGCGG + Exonic
1082076778 11:47981015-47981037 GCCGGGTGGGCTCGGGCGGGGGG + Intronic
1083272948 11:61581162-61581184 GGCGTTCGGCGGCTGGCGGGCGG - Intergenic
1083579085 11:63813532-63813554 GCCGGCGAGCGGCGGGCGGGCGG + Exonic
1084010917 11:66347806-66347828 GCCGGCGGGGCCCGGGCGGGCGG - Intergenic
1084385735 11:68841746-68841768 CCCGGTCGCCCGCGGTGGGGAGG - Intronic
1084946691 11:72642487-72642509 GCGGGCCGGGGGCGGGCGGGGGG - Intronic
1085270591 11:75267601-75267623 GGGGGTGGGCCGCGGGTGGGCGG - Intronic
1085327242 11:75615951-75615973 GCGGGGCGGCAGGGGGCGGGGGG + Intronic
1085507162 11:77067091-77067113 GCCGGTAGGAGGCGGGCGGAGGG + Exonic
1085784976 11:79440721-79440743 GCCGGTCGTGCGCGCGCGGCTGG - Intronic
1088527370 11:110771659-110771681 GCCTGTCGGGGGCGGGCAGGGGG + Intergenic
1088764715 11:112963462-112963484 ACCGGCCGACCGCGGGCCGGGGG + Intronic
1089442803 11:118530927-118530949 CCCGGGCGTCCGCGGGCGAGGGG + Exonic
1090635795 11:128689852-128689874 GCGGGAGGGCCGGGGGCGGGCGG - Intronic
1090817873 11:130314706-130314728 GACGGTTGGCCGAGGGCAGGCGG + Intergenic
1090832277 11:130428002-130428024 GCCGGGCGACCGGGGGCGAGCGG - Exonic
1094199133 12:27779826-27779848 GCCGGCGCGCCCCGGGCGGGCGG + Intergenic
1096435872 12:51591008-51591030 GCCGCGGGGGCGCGGGCGGGCGG + Intronic
1096495459 12:52037165-52037187 CGCGGGCGGCCGCGGGCGCGGGG + Intronic
1098426095 12:70366653-70366675 GCCCGACTGCCTCGGGCGGGAGG - Exonic
1103521216 12:121537822-121537844 CCCTGTAGCCCGCGGGCGGGAGG + Intronic
1103595274 12:122021596-122021618 GCCGGTCTGCGGGGCGCGGGGGG - Exonic
1103691024 12:122774542-122774564 GGGGGTCGGCCGAGGGCGCGGGG + Exonic
1103698553 12:122835668-122835690 GGCGGGCGGCGGCGGGCGGGCGG + Intronic
1103764727 12:123271868-123271890 GCGGGGCGGCCGGGGCCGGGAGG + Exonic
1106087638 13:26557745-26557767 GCCGGGCGGCCGCGGCGCGGCGG + Exonic
1112337685 13:98528119-98528141 GCAGGTTGGCCCAGGGCGGGAGG + Intronic
1112402038 13:99086194-99086216 GCGGGACGACCGCGGGCCGGGGG - Intronic
1114252124 14:20970830-20970852 GCCTGTCTGCCGCGGGCTGCAGG - Intergenic
1114620687 14:24094443-24094465 GCGGGTGGGCCCCGGGCCGGGGG - Intronic
1117072569 14:52069490-52069512 GCTGGCAGGGCGCGGGCGGGTGG + Intergenic
1117309833 14:54510142-54510164 GCCGGAGGGCCGCGGGCCGGAGG + Intronic
1118289391 14:64505326-64505348 GCGGCTCGGCGGCGGGTGGGAGG + Intronic
1119539130 14:75427667-75427689 GCCGGGCGGCGGTGCGCGGGGGG + Intergenic
1119786917 14:77320906-77320928 GCCGGCCGGCCCGGGGCGGGGGG + Exonic
1122077643 14:99246251-99246273 GCCGGGCGGCGAGGGGCGGGCGG - Intronic
1122112161 14:99510423-99510445 GCAGGTGGGCCGTAGGCGGGGGG - Exonic
1122209442 14:100165574-100165596 ACCGGGCGGCCGCGGACGGGCGG + Intergenic
1122221024 14:100239185-100239207 GCTCCTCGGCTGCGGGCGGGCGG - Exonic
1122221251 14:100240104-100240126 GGCGGCAGGCCGCGGGGGGGAGG + Intronic
1123004453 14:105314685-105314707 GCGGGGCGGCCGGGGGCGCGCGG + Exonic
1123684394 15:22786850-22786872 GGCGGCAGGCGGCGGGCGGGTGG + Intronic
1123853651 15:24384859-24384881 GCTGGTGGGCCCGGGGCGGGGGG - Intergenic
1126649648 15:50908289-50908311 GCCTGTGGGAAGCGGGCGGGTGG + Intergenic
1127074947 15:55316418-55316440 GCCTGTCGGGGGCGGGTGGGGGG + Intronic
1127207230 15:56733427-56733449 GCAGGGCGGGCGGGGGCGGGGGG + Intronic
1127867465 15:63043672-63043694 GGCGGGCGGGCGCGGGCGGCCGG - Intronic
1128454128 15:67823237-67823259 GCGCGTGGCCCGCGGGCGGGCGG + Intronic
1129468646 15:75738332-75738354 GCCGGACGGGCGTGGCCGGGAGG - Intergenic
1132683807 16:1154045-1154067 CCCGGCCGGCGGGGGGCGGGGGG + Intronic
1133031627 16:3013917-3013939 GCCGCTCGACCTGGGGCGGGGGG - Exonic
1133249951 16:4474391-4474413 GCCGGTGGGACCCGGGCCGGGGG - Exonic
1133784450 16:8963633-8963655 GCGGGCCGGCCGGGGGCGGAGGG + Intronic
1134529887 16:14975085-14975107 CCCCGCCGGCCGCGGGCGCGGGG + Exonic
1135429940 16:22374463-22374485 GCCGGTCGGCGGCCGCCGGCGGG - Exonic
1136779000 16:32885602-32885624 GCGGGCCGGCCGGGGGCCGGGGG + Intergenic
1136891618 16:33975916-33975938 GCGGGCCGGCCGGGGGCCGGGGG - Intergenic
1137926464 16:52546601-52546623 GCCGGTGGGCCGGGGGGCGGGGG - Intronic
1139140905 16:64261201-64261223 GCGCCTGGGCCGCGGGCGGGGGG - Intergenic
1139384061 16:66552799-66552821 GCCGGGCCGCGGAGGGCGGGAGG + Intronic
1139484764 16:67249228-67249250 GCGGGTCCGCCGCTGGCGGTCGG - Intronic
1140078632 16:71723949-71723971 GCCGGCGGGCCGCGGGGGGCGGG - Intronic
1140442506 16:74998886-74998908 ACAGGCCGGCCGGGGGCGGGCGG + Intronic
1140442508 16:74998890-74998912 GCCGGCCGGGGGCGGGCGGTGGG + Intronic
1141054599 16:80803964-80803986 GGCGGCGGGCGGCGGGCGGGAGG + Intronic
1141608545 16:85169145-85169167 GCGGGGCGGCGGCGGGCGGGAGG - Intergenic
1141694742 16:85614053-85614075 GCCGCTCCGCCGGGGGTGGGGGG - Intronic
1142132341 16:88436784-88436806 GCCGGCCGGCCAAGGGCAGGCGG + Exonic
1142136352 16:88453572-88453594 GGCGGGCGGCGGCGGGCGGCGGG - Exonic
1142299412 16:89247725-89247747 GCAGGTTGGCCGCGGGCGCGCGG + Intergenic
1142350298 16:89576442-89576464 GCCGGCCGACGGGGGGCGGGAGG + Intronic
1203081411 16_KI270728v1_random:1147691-1147713 GCGGGCCGGCCGGGGGCCGGGGG + Intergenic
1142590990 17:1006051-1006073 GCAGGGTGGCTGCGGGCGGGTGG - Exonic
1142683324 17:1562600-1562622 GCCGGCGGGCAGCGGGCGGGAGG - Exonic
1143590956 17:7885532-7885554 GCCGGACGGCGGCGTGGGGGAGG + Intronic
1147989643 17:44324869-44324891 GCTGGTCGGCCCGCGGCGGGCGG - Intronic
1148110820 17:45143981-45144003 GCTGGGAGGCCGCGGGAGGGAGG + Exonic
1148122758 17:45222271-45222293 GCGGGTCGGGCGCGGGCGGGGGG + Intronic
1148774583 17:50088344-50088366 CCAGGTGGGCCGGGGGCGGGGGG - Intronic
1149313997 17:55421872-55421894 ACCGGGCGGCTGGGGGCGGGAGG + Exonic
1150830263 17:68512521-68512543 GACGGGCGGCGGCGGGCGCGAGG - Exonic
1151783855 17:76265671-76265693 GCCGGGCGGCGGCGGGGGCGGGG + Intronic
1151836625 17:76586281-76586303 GCGGGTGGGCGGCGGCCGGGAGG + Intronic
1151856746 17:76727039-76727061 GTCGTTGGGCCCCGGGCGGGCGG - Exonic
1152037059 17:77880074-77880096 GCCGGGCGGCAGGAGGCGGGAGG + Intergenic
1152644193 17:81461252-81461274 GGTGGGCGGCGGCGGGCGGGCGG + Exonic
1152732169 17:81977755-81977777 ACCCGTCCGCCCCGGGCGGGCGG - Intronic
1152938315 17:83153081-83153103 GACAGTCGGCCCCGGGCGAGGGG + Intergenic
1153238877 18:3013186-3013208 GCCGGTCGGGGGCGCGCGCGGGG + Intronic
1153688195 18:7567202-7567224 GGCGCTCGGGCGCGGGCCGGCGG + Exonic
1153794475 18:8609682-8609704 GGCGGGCGGCGGCGGGCGGCGGG + Exonic
1153805568 18:8706185-8706207 TCCGGGCGGCCGGGGTCGGGGGG - Intronic
1155096403 18:22559889-22559911 GGCGGGCGGCCGGGGGCTGGCGG + Intergenic
1160499303 18:79394447-79394469 GCCGGTGGGCGGGGGTCGGGGGG - Intergenic
1160556574 18:79729453-79729475 GCCGGTCGGCGTCAGGCAGGGGG - Intronic
1160726922 19:621459-621481 GCAGGTGGGCCTCGGGCGGCTGG + Exonic
1160745377 19:708931-708953 TCCGGGCGGCGGCGGGCGCGGGG - Intergenic
1160824891 19:1074884-1074906 GGCGGGCGGGCGGGGGCGGGCGG + Intronic
1160858481 19:1227761-1227783 GCCGGGCGGCCGAGGGGGGAGGG - Exonic
1160864367 19:1250537-1250559 GGCGGCCGGCCGGGGGCGCGCGG - Intronic
1160919665 19:1513599-1513621 CCCCGTGGGCCGCGCGCGGGGGG + Intronic
1161207200 19:3047268-3047290 GCGGGGCGGCCGCGGCGGGGAGG + Intronic
1161231954 19:3178890-3178912 GCCGGCTGGCCGGGCGCGGGGGG + Exonic
1161241131 19:3224612-3224634 CCGGGGCGGGCGCGGGCGGGAGG + Intergenic
1161257993 19:3320403-3320425 GCCGGGCGGGCGCGGGCCAGGGG - Intergenic
1161412459 19:4123990-4124012 TCGGGGCGGCCGAGGGCGGGCGG + Exonic
1161723855 19:5917532-5917554 GCCGGTGGGGTGGGGGCGGGTGG + Exonic
1162145553 19:8610825-8610847 GCCGGGCGGCGGCAGGCGGGCGG - Intergenic
1162435362 19:10654761-10654783 GCCGAGGGGCCGCGTGCGGGGGG - Intronic
1162470743 19:10871070-10871092 GCCGGGCGGGCCCGGGGGGGTGG + Intergenic
1162519329 19:11170203-11170225 GGCCGTCAGCCACGGGCGGGTGG - Exonic
1162935243 19:13978709-13978731 GGCGGGGGGCAGCGGGCGGGCGG - Intronic
1163138634 19:15331942-15331964 GGCGGTCGGGGGCGGGCGGGGGG - Intronic
1163138656 19:15331986-15332008 GCCGGCGGGGCGCGGGTGGGGGG - Intronic
1163559383 19:18009928-18009950 GCCGGTGGGCCCCGGGCAGCGGG + Exonic
1163807011 19:19405683-19405705 CCCAGCCGGGCGCGGGCGGGCGG + Intronic
1165157278 19:33796261-33796283 GCCGGCCGGCGGGGGGCGGGGGG + Intronic
1166546951 19:43639682-43639704 GCCGGCCGGGCTGGGGCGGGGGG - Intronic
1166723683 19:45012285-45012307 GGCGAGCGGCCCCGGGCGGGTGG + Intronic
1167040589 19:47020745-47020767 GCCGGCCCGGCGCGGGCGTGAGG + Intronic
1167414362 19:49362386-49362408 GCTGGGGAGCCGCGGGCGGGCGG + Intronic
1167557061 19:50203346-50203368 GGGGGGCGGCCGGGGGCGGGAGG - Intronic
1167709953 19:51104417-51104439 GCCGGGCGGCAGCAGGCGGCCGG + Exonic
1168078486 19:53992918-53992940 GGCGGGGGGCCGCGGGCCGGCGG + Exonic
1168408058 19:56120991-56121013 GCCGGGGTGACGCGGGCGGGGGG - Intronic
925730672 2:6917762-6917784 GCCCGGTGGCAGCGGGCGGGGGG + Intronic
926250942 2:11155289-11155311 GCGGGGCGGGCCCGGGCGGGAGG + Intronic
926250959 2:11155318-11155340 GCGGGGCGGGCCCGGGCGGGAGG + Intronic
927168640 2:20350487-20350509 GCCGATCGCCAGCGGGAGGGCGG - Intronic
927982067 2:27380551-27380573 GTCGGGCGGCCGCAGGCCGGAGG - Exonic
928186534 2:29115662-29115684 GCAGGTGGGCCGGGGGCGCGCGG + Exonic
928511722 2:32009962-32009984 GCCGGCCGGCCCCGGGCTGCCGG + Intronic
928964985 2:36966817-36966839 GCCGGCTGGGCGCGGGCGGGCGG + Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
932702846 2:74002826-74002848 GCCGGGCGGACGCGGGCCGGGGG + Intronic
935250142 2:101253433-101253455 TCCTGGCCGCCGCGGGCGGGCGG - Exonic
935963444 2:108449250-108449272 GCGGGCCGGCGGCGGGCTGGCGG + Exonic
937307245 2:120879825-120879847 GCCCGTCTGCCGCGGGAGGCGGG + Intronic
937321345 2:120962581-120962603 GCCGGTCGGCCACGGGTGACTGG - Intronic
938034873 2:128027635-128027657 GCCGGGGGAGCGCGGGCGGGCGG - Intronic
938297193 2:130185662-130185684 GCTGGTAGGCCGGGGGCGGGAGG + Intronic
941979085 2:171434728-171434750 GACGGAGGGCCGCGGGCGCGCGG + Exonic
942450781 2:176106950-176106972 GGAGGGCGGACGCGGGCGGGCGG + Intronic
944221849 2:197310910-197310932 GCGGCTCGGCTGCGGGCGGCAGG - Intronic
946622464 2:221573624-221573646 GCCGGGCGGCCGCTGGGAGGTGG + Intronic
947119409 2:226799807-226799829 GCCGGGCAGCCGCCGCCGGGAGG + Intergenic
947549895 2:231038216-231038238 CCCGGCTGGGCGCGGGCGGGCGG + Intronic
947800948 2:232928237-232928259 GCCGGGCGGCGGCGGGGCGGGGG + Intronic
1169191457 20:3661136-3661158 GCCCGGCGGCAGCGGGCGCGGGG + Exonic
1169557604 20:6767613-6767635 GGTGTTCGGCCGCGGCCGGGAGG + Intergenic
1170688277 20:18588309-18588331 GCCGGTCGGGCACGTGCAGGGGG - Intronic
1170811589 20:19678619-19678641 GGCGGCTGGCCCCGGGCGGGGGG + Intronic
1172421991 20:34825582-34825604 GGCGGCCGGGCGCGGGCGGCGGG - Intronic
1172534796 20:35664816-35664838 GGCTGTCGGCCGCGGGGCGGAGG - Exonic
1173741912 20:45407277-45407299 ACCGTGCGGCCGCGGGCTGGCGG - Intronic
1173743557 20:45419409-45419431 GCCTGGCAGCCGGGGGCGGGGGG + Intronic
1175136373 20:56827405-56827427 GCCGGGCGGGCGGGGGCAGGCGG - Intergenic
1175414918 20:58794902-58794924 GCAGGACAGCCGCGGGCTGGGGG - Intergenic
1175428895 20:58889293-58889315 GCGGGGCGGCGGCGGGCGGCCGG + Intronic
1175429342 20:58891162-58891184 CCCGGCCGGGCGCGGGCGGAGGG + Intronic
1176005601 20:62860995-62861017 GCCCGGCGGCCGGGGGCTGGCGG - Intronic
1176161833 20:63652450-63652472 GCCGGGCGACCTCGGGCGCGAGG - Intronic
1176207176 20:63895380-63895402 GGCGGGCGGGCGCGGGTGGGGGG + Intronic
1176952648 21:15064889-15064911 GGCGGACGGGCGCGCGCGGGTGG + Exonic
1179209356 21:39312958-39312980 GGCGGGGGGCCGGGGGCGGGCGG + Intronic
1179209367 21:39312976-39312998 GGCGGCGGGCGGCGGGCGGGGGG + Intronic
1179375459 21:40846765-40846787 GGCGGCGGGCGGCGGGCGGGCGG - Exonic
1180064299 21:45405069-45405091 GCGGGGCGGGCGCGGGCAGGGGG - Intergenic
1180091856 21:45537533-45537555 GCCGGGCGGCCGCCTGTGGGTGG - Intronic
1180091917 21:45537730-45537752 GCCGGGCGGCCGCCTGTGGGTGG - Intronic
1180631359 22:17232453-17232475 GCCGGTGCGGCGGGGGCGGGGGG - Intergenic
1180852767 22:19029760-19029782 GGCGGCCGGGCGCGGGCGAGAGG + Intergenic
1181956292 22:26589964-26589986 GCGGGTCGGCCTCGGGCGCCTGG - Intronic
1182464422 22:30505648-30505670 GCCAGGCGGCGGCGGGCGGGCGG - Exonic
1183201409 22:36387754-36387776 GGCAGGCGGCGGCGGGCGGGCGG - Intronic
1183601512 22:38843165-38843187 GCCGGACGACCGCGGCCGGGCGG + Intronic
1184276465 22:43411899-43411921 GGCGGGCGGCGGCGGGCGGGGGG + Intronic
1184276558 22:43412180-43412202 GCGCGGCGGGCGCGGGCGGGAGG + Intronic
1184523002 22:45007087-45007109 GGCGCGCGGCCGGGGGCGGGGGG + Intronic
1184788063 22:46681289-46681311 GCCTGTGGGCCGAGGGTGGGTGG - Intergenic
1185188592 22:49418346-49418368 GCCAGACGGCCTCGGGCGCGTGG - Intronic
950549020 3:13655300-13655322 GCCGGGCGGCTGCCAGCGGGAGG - Intergenic
951078537 3:18425256-18425278 TCCGGGCGGCGGCGGGCGGCCGG - Intronic
951558617 3:23945216-23945238 AGCGGCCGGCCGAGGGCGGGCGG + Intronic
952706175 3:36380350-36380372 GCCACTCGGCAGCGGGCGAGCGG - Exonic
953705268 3:45225974-45225996 GACGGGCGGCAGCGGGCAGGCGG + Exonic
953909095 3:46882887-46882909 GCCGAACGGCCGGGGGCTGGCGG + Intronic
954004085 3:47578462-47578484 GCCGCCCGGCCGCGGCCAGGCGG + Intronic
954256647 3:49411980-49412002 GGCGGGCGGCGGCGGGAGGGCGG + Exonic
954778977 3:53045666-53045688 GCCGGGCGCCGGCGGGCGCGCGG - Intronic
959963992 3:112333275-112333297 GCCGGTGGCCCTGGGGCGGGCGG + Intronic
962129865 3:132660711-132660733 GCCGGTCGGAGGCAGGCGCGGGG + Exonic
965714828 3:171591613-171591635 GCCTGTCGGGCCCGGGCTGGGGG - Intergenic
968434070 4:576089-576111 GGCGGGCGGCGGCGGGCGCGCGG - Intergenic
968479140 4:826174-826196 CACGCTCGGACGCGGGCGGGGGG - Exonic
968511436 4:997518-997540 GCCGCTCAGCCGCGGCCGCGCGG + Intronic
968729252 4:2261981-2262003 GGCGGACGGGCGCGGGCGGGAGG - Exonic
969379011 4:6782500-6782522 GGCGGTGGGCCGCGGGCTGACGG - Intronic
975674459 4:76812378-76812400 GCGGGTCGGCCGAAGGCGGGAGG - Intergenic
975710648 4:77157466-77157488 ACCGCGAGGCCGCGGGCGGGTGG + Exonic
976765405 4:88592882-88592904 GGCGGCCGAGCGCGGGCGGGAGG - Intronic
980541504 4:134201719-134201741 GGCGGTCGTCTGCGGGCGGGCGG + Exonic
985445503 4:190019206-190019228 GCAGCCCGGCCGCGGGCGAGCGG + Intergenic
985823387 5:2176077-2176099 GCCGGCCGGCAGCGAGTGGGAGG + Intergenic
985995715 5:3595966-3595988 GCCGGCCGGGCGCGCTCGGGCGG - Intergenic
986449491 5:7850760-7850782 GGCGGGCGGCCGCGGAGGGGCGG - Intronic
989983086 5:50666558-50666580 GAGGGTCTGCGGCGGGCGGGCGG + Intronic
990545162 5:56815352-56815374 GCCCGGCGGCCGCAGGTGGGAGG - Intergenic
993501938 5:88674960-88674982 GCAGGGCTGCCGCGGGCGGAAGG + Intergenic
997564229 5:134874710-134874732 GCCGGTGGGCTGAGGGCCGGTGG + Intronic
998352923 5:141512715-141512737 GCGGGTGGGCAGCGGGCGGCGGG + Exonic
999288817 5:150410060-150410082 GACGGTGGGCGGGGGGCGGGGGG + Intronic
999462696 5:151771060-151771082 GCGAGGCGGCCGCGGGCGTGTGG - Intronic
1001401938 5:171451075-171451097 GCGGCTCGCCCGCGGGCGGGAGG - Intronic
1002082174 5:176743602-176743624 GCCGGCCGGGCTGGGGCGGGAGG - Intergenic
1002190163 5:177473667-177473689 GCCGGCCGGCGGGGGGCGGGGGG + Intronic
1002428544 5:179189891-179189913 GCGGGTCCGGCGGGGGCGGGTGG + Intronic
1002884596 6:1282211-1282233 GCTGGTCGGCGGTGGGCGTGGGG - Intergenic
1003049252 6:2765425-2765447 AGCGGCCGGCCGAGGGCGGGCGG + Exonic
1006665084 6:35688263-35688285 GCCGGGACGCCGCGGGCGCGGGG - Intronic
1007614952 6:43174339-43174361 GCAGGCGGGCTGCGGGCGGGAGG - Intronic
1008545102 6:52577079-52577101 TACGGGCGGCCGGGGGCGGGCGG - Intergenic
1012972661 6:105748239-105748261 GCCGGTGGGCGGGGGGCAGGGGG + Intergenic
1013048899 6:106512699-106512721 GCCCGGGGGCCGCTGGCGGGCGG - Exonic
1013793219 6:113858606-113858628 GCCGGGCGGCCCCTCGCGGGTGG - Intronic
1014755895 6:125301811-125301833 GCCGGGAGGCCGCGGCCGAGCGG - Intronic
1015244539 6:131062614-131062636 GCGGGCCGGCCGCGCGCGTGGGG - Intronic
1016386813 6:143537236-143537258 GAGGGCCGGCCGCGGGCAGGTGG + Intronic
1016590172 6:145735367-145735389 GCCGGCCGGCCTCAGGCGGACGG + Exonic
1018203433 6:161415610-161415632 GGCGGTCGGGGGCTGGCGGGGGG - Intronic
1018876653 6:167827296-167827318 GGCGGGCGGCGGCGGGGGGGAGG - Intronic
1018876662 6:167827310-167827332 GCGGGTCCGCGGCTGGCGGGCGG - Intronic
1019343000 7:517345-517367 GCGGGGAGGGCGCGGGCGGGCGG - Intronic
1020008946 7:4798230-4798252 GCGGGTCGGCAGAGGGCGCGGGG + Intronic
1021558513 7:21945750-21945772 TCCGGACGGCGGCGGGCGGCCGG + Intronic
1021719250 7:23490441-23490463 GGCGGGCGGGCGCGGGCGGGCGG + Intergenic
1022101947 7:27174093-27174115 GCAGGTCGGCGGCGGGCGGCAGG + Exonic
1022207892 7:28180619-28180641 GCCGGGCGGGCGAGGGAGGGAGG + Exonic
1024085539 7:45889033-45889055 GCCGGGCGGGGGCGGGCGGCAGG - Intronic
1029896656 7:103990231-103990253 GCCGGGCGGCCGCGGCGGGAGGG - Intergenic
1032068634 7:128790985-128791007 GCCGGCCGGGCGGGGGAGGGAGG + Intronic
1032117020 7:129126381-129126403 TCGGGGCGGCCGAGGGCGGGCGG - Intergenic
1032344397 7:131106049-131106071 CCCGGCAGGCCGGGGGCGGGAGG + Intergenic
1032410362 7:131689833-131689855 GCCGCTTAGCCGCGGGCAGGAGG + Intergenic
1033662056 7:143408876-143408898 GCGGGCCGGGCGGGGGCGGGGGG + Exonic
1034228085 7:149497961-149497983 GCCGGACTGCCGAGCGCGGGGGG + Intergenic
1036398295 8:8386674-8386696 GCCGGTCCGGGGCGGGAGGGTGG - Intergenic
1037305225 8:17497262-17497284 GCCGAGAGGCCGCGGGCGAGGGG + Intronic
1037589930 8:20303916-20303938 GCGGGTTGGCAGCGGCCGGGCGG - Exonic
1037768969 8:21788029-21788051 GCCGGTGGGGGGCTGGCGGGAGG - Intronic
1038540233 8:28385530-28385552 GCGGGTCGCCCGCGGGCGGAGGG + Intronic
1038540373 8:28385915-28385937 GCCCGACAGCCGCGGGCGCGCGG + Intronic
1039936665 8:42051856-42051878 GCTGGGCGGCCGGGGGCGGCCGG + Intronic
1040501454 8:48008673-48008695 GCGCGTCGGCCGCGCGCCGGCGG + Intronic
1042367336 8:67952322-67952344 GCCGGGCAGCAGCGGGCGCGCGG + Exonic
1045063665 8:98427607-98427629 GCCTGTCTGCGGCGAGCGGGCGG + Intronic
1045231399 8:100310151-100310173 GCGGGGCGGCCGGGGGCGGGAGG - Intronic
1045277635 8:100721853-100721875 GCTGCGGGGCCGCGGGCGGGCGG + Exonic
1045459321 8:102412502-102412524 GCCCGTCTGCCGCTGGCCGGCGG - Exonic
1047381845 8:124371995-124372017 GCCGGGCGGCCCCAGGCGGCTGG - Exonic
1047753004 8:127896779-127896801 GCCTGTGGGTCGGGGGCGGGGGG - Intergenic
1049419549 8:142510765-142510787 GCCTGGCGGCGGCGGGCGGACGG + Intronic
1049625437 8:143617676-143617698 GTCCGCCGGCCGCGCGCGGGCGG + Intronic
1049693562 8:143973151-143973173 TGGGGTGGGCCGCGGGCGGGTGG - Intronic
1049746898 8:144266786-144266808 GCCGGCGGGCCGGGGGCGGGGGG + Exonic
1050276633 9:4007870-4007892 GCAGGTCGGGCGGGGGTGGGTGG + Intronic
1050351024 9:4741304-4741326 GGCGCTCGGTCGGGGGCGGGGGG - Exonic
1053203146 9:36166197-36166219 GCTGGAGCGCCGCGGGCGGGAGG - Intergenic
1054400515 9:64711888-64711910 GGCGGTCGGCGGCGGGGCGGCGG - Intergenic
1054400524 9:64711914-64711936 GGCGGTCGGCGGCGGGGCGGCGG - Intergenic
1054434130 9:65196229-65196251 GGCGGTCGGCGGCGGGGCGGCGG - Intergenic
1054496266 9:65825477-65825499 GGCGGTCGGCGGCGGGGCGGCGG + Intergenic
1054906924 9:70420322-70420344 GCCGGGCGGGCGCGGCCGCGGGG - Intergenic
1056773882 9:89497889-89497911 GCCGGGCTGGCGCGGGAGGGAGG - Intronic
1057716696 9:97501644-97501666 CCCGGGCGGCCGCGGGCGGGCGG - Exonic
1057773345 9:97985067-97985089 GCCGGTCCGCGGCGGGGGGGGGG - Intronic
1058254860 9:102749217-102749239 GCCGGGGGGCGGGGGGCGGGGGG + Intergenic
1058348975 9:103999344-103999366 GCCCTTCGGCCGCGGGCCGGCGG + Intergenic
1060106778 9:120877435-120877457 GCGGGGCGGGCGGGGGCGGGCGG - Intronic
1060468671 9:123929957-123929979 GCCGGTCGGCCGCGGGCGGGCGG - Exonic
1060479230 9:124008509-124008531 GCCGGGCGGCCGCGGAAGGAGGG - Intronic
1061061151 9:128250973-128250995 GCCGGACGGGCGTGGCCGGGAGG + Intronic
1061257383 9:129460558-129460580 CGAGGTCGGCCGCGGGCGGCTGG + Intergenic
1061580095 9:131531120-131531142 GACGGTCGGCCTCCGGCGCGGGG + Exonic
1061680894 9:132242027-132242049 GCGGGGCGGCCCCGGGCGCGCGG - Exonic
1062022667 9:134326698-134326720 GCCGGGGGCCGGCGGGCGGGAGG + Intronic
1062306070 9:135907669-135907691 GCGGGGCGGGCGCGGGCTGGCGG - Intergenic
1062326204 9:136013711-136013733 GCCGGTCGGCCCCAGGACGGTGG - Intronic
1062462009 9:136666056-136666078 CCCTGCCGGCGGCGGGCGGGCGG + Intronic
1062562327 9:137147015-137147037 GCCTGTCGGGCGCTGGGGGGAGG - Intronic
1062600314 9:137316296-137316318 GCGCGAAGGCCGCGGGCGGGCGG - Intronic
1062653565 9:137590542-137590564 GCCGAGCGGCGGCGGGCCGGGGG - Intergenic
1185837771 X:3361060-3361082 GGCGGACGGCAGCGGGCCGGCGG - Intergenic
1186981570 X:14962585-14962607 GACGGCCGGTCGGGGGCGGGGGG + Intergenic
1188892304 X:35625907-35625929 GCCGGTGGGACGCGGGCTTGAGG + Intergenic
1192214665 X:69150173-69150195 GCTGGTCGGCCGCGGAGGGGCGG + Intergenic
1192224916 X:69221590-69221612 GCGGGTCGGCCGCGGAGGGGCGG - Intergenic
1195113027 X:101666154-101666176 GGCGGTGGGGCGGGGGCGGGGGG + Intergenic
1195668261 X:107449593-107449615 GCCGGACGGCCGAGGAGGGGAGG - Intergenic
1200098171 X:153673829-153673851 GCCGGCGGGGCGCGGGCGGGGGG - Intronic
1200100617 X:153687848-153687870 GCCGGCCGGCCGTGGGGGTGGGG + Intronic
1200100805 X:153688452-153688474 GCGGGCCGGCCGGGGGCCGGGGG - Exonic
1200123778 X:153803831-153803853 GCCGGTGGCCCTCGGGTGGGCGG - Exonic
1200418280 Y:2935532-2935554 GCCGGCCGGCCTAGCGCGGGAGG - Exonic