ID: 1060470014

View in Genome Browser
Species Human (GRCh38)
Location 9:123940755-123940777
Sequence CCCAGCTCCTTCCTTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060470014_1060470017 -9 Left 1060470014 9:123940755-123940777 CCTCCATGAAGGAAGGAGCTGGG No data
Right 1060470017 9:123940769-123940791 GGAGCTGGGTTGCTCCGTGAAGG No data
1060470014_1060470019 12 Left 1060470014 9:123940755-123940777 CCTCCATGAAGGAAGGAGCTGGG No data
Right 1060470019 9:123940790-123940812 GGCTGTTCTGAATTCAGCAAAGG No data
1060470014_1060470020 25 Left 1060470014 9:123940755-123940777 CCTCCATGAAGGAAGGAGCTGGG No data
Right 1060470020 9:123940803-123940825 TCAGCAAAGGCAGCTGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060470014 Original CRISPR CCCAGCTCCTTCCTTCATGG AGG (reversed) Intergenic
No off target data available for this crispr