ID: 1060470017

View in Genome Browser
Species Human (GRCh38)
Location 9:123940769-123940791
Sequence GGAGCTGGGTTGCTCCGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060470012_1060470017 -6 Left 1060470012 9:123940752-123940774 CCACCTCCATGAAGGAAGGAGCT No data
Right 1060470017 9:123940769-123940791 GGAGCTGGGTTGCTCCGTGAAGG No data
1060470014_1060470017 -9 Left 1060470014 9:123940755-123940777 CCTCCATGAAGGAAGGAGCTGGG No data
Right 1060470017 9:123940769-123940791 GGAGCTGGGTTGCTCCGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060470017 Original CRISPR GGAGCTGGGTTGCTCCGTGA AGG Intergenic
No off target data available for this crispr