ID: 1060470019

View in Genome Browser
Species Human (GRCh38)
Location 9:123940790-123940812
Sequence GGCTGTTCTGAATTCAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060470016_1060470019 9 Left 1060470016 9:123940758-123940780 CCATGAAGGAAGGAGCTGGGTTG No data
Right 1060470019 9:123940790-123940812 GGCTGTTCTGAATTCAGCAAAGG No data
1060470012_1060470019 15 Left 1060470012 9:123940752-123940774 CCACCTCCATGAAGGAAGGAGCT No data
Right 1060470019 9:123940790-123940812 GGCTGTTCTGAATTCAGCAAAGG No data
1060470014_1060470019 12 Left 1060470014 9:123940755-123940777 CCTCCATGAAGGAAGGAGCTGGG No data
Right 1060470019 9:123940790-123940812 GGCTGTTCTGAATTCAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060470019 Original CRISPR GGCTGTTCTGAATTCAGCAA AGG Intergenic
No off target data available for this crispr