ID: 1060472741

View in Genome Browser
Species Human (GRCh38)
Location 9:123962167-123962189
Sequence TAGCTCCGTGAGTTAGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060472737_1060472741 19 Left 1060472737 9:123962125-123962147 CCATGCCGTTGCTGAATCTGTTT No data
Right 1060472741 9:123962167-123962189 TAGCTCCGTGAGTTAGGAAATGG No data
1060472738_1060472741 14 Left 1060472738 9:123962130-123962152 CCGTTGCTGAATCTGTTTAATGT No data
Right 1060472741 9:123962167-123962189 TAGCTCCGTGAGTTAGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060472741 Original CRISPR TAGCTCCGTGAGTTAGGAAA TGG Intergenic
No off target data available for this crispr