ID: 1060473342

View in Genome Browser
Species Human (GRCh38)
Location 9:123966903-123966925
Sequence CAGTGAGGGACTGCAGTATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060473342_1060473348 10 Left 1060473342 9:123966903-123966925 CCCTATACTGCAGTCCCTCACTG No data
Right 1060473348 9:123966936-123966958 ATCCGGGCACTTATCTCCTTTGG No data
1060473342_1060473346 -7 Left 1060473342 9:123966903-123966925 CCCTATACTGCAGTCCCTCACTG No data
Right 1060473346 9:123966919-123966941 CTCACTGCGCTTTATACATCCGG No data
1060473342_1060473347 -6 Left 1060473342 9:123966903-123966925 CCCTATACTGCAGTCCCTCACTG No data
Right 1060473347 9:123966920-123966942 TCACTGCGCTTTATACATCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060473342 Original CRISPR CAGTGAGGGACTGCAGTATA GGG (reversed) Intergenic
No off target data available for this crispr