ID: 1060473346

View in Genome Browser
Species Human (GRCh38)
Location 9:123966919-123966941
Sequence CTCACTGCGCTTTATACATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060473341_1060473346 -1 Left 1060473341 9:123966897-123966919 CCACAACCCTATACTGCAGTCCC No data
Right 1060473346 9:123966919-123966941 CTCACTGCGCTTTATACATCCGG No data
1060473340_1060473346 11 Left 1060473340 9:123966885-123966907 CCACACTTGTAGCCACAACCCTA No data
Right 1060473346 9:123966919-123966941 CTCACTGCGCTTTATACATCCGG No data
1060473343_1060473346 -8 Left 1060473343 9:123966904-123966926 CCTATACTGCAGTCCCTCACTGC No data
Right 1060473346 9:123966919-123966941 CTCACTGCGCTTTATACATCCGG No data
1060473339_1060473346 18 Left 1060473339 9:123966878-123966900 CCAAAGTCCACACTTGTAGCCAC No data
Right 1060473346 9:123966919-123966941 CTCACTGCGCTTTATACATCCGG No data
1060473342_1060473346 -7 Left 1060473342 9:123966903-123966925 CCCTATACTGCAGTCCCTCACTG No data
Right 1060473346 9:123966919-123966941 CTCACTGCGCTTTATACATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060473346 Original CRISPR CTCACTGCGCTTTATACATC CGG Intergenic
No off target data available for this crispr