ID: 1060473348

View in Genome Browser
Species Human (GRCh38)
Location 9:123966936-123966958
Sequence ATCCGGGCACTTATCTCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060473345_1060473348 -5 Left 1060473345 9:123966918-123966940 CCTCACTGCGCTTTATACATCCG No data
Right 1060473348 9:123966936-123966958 ATCCGGGCACTTATCTCCTTTGG No data
1060473343_1060473348 9 Left 1060473343 9:123966904-123966926 CCTATACTGCAGTCCCTCACTGC No data
Right 1060473348 9:123966936-123966958 ATCCGGGCACTTATCTCCTTTGG No data
1060473342_1060473348 10 Left 1060473342 9:123966903-123966925 CCCTATACTGCAGTCCCTCACTG No data
Right 1060473348 9:123966936-123966958 ATCCGGGCACTTATCTCCTTTGG No data
1060473341_1060473348 16 Left 1060473341 9:123966897-123966919 CCACAACCCTATACTGCAGTCCC No data
Right 1060473348 9:123966936-123966958 ATCCGGGCACTTATCTCCTTTGG No data
1060473344_1060473348 -4 Left 1060473344 9:123966917-123966939 CCCTCACTGCGCTTTATACATCC No data
Right 1060473348 9:123966936-123966958 ATCCGGGCACTTATCTCCTTTGG No data
1060473340_1060473348 28 Left 1060473340 9:123966885-123966907 CCACACTTGTAGCCACAACCCTA No data
Right 1060473348 9:123966936-123966958 ATCCGGGCACTTATCTCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060473348 Original CRISPR ATCCGGGCACTTATCTCCTT TGG Intergenic
No off target data available for this crispr