ID: 1060474592

View in Genome Browser
Species Human (GRCh38)
Location 9:123977191-123977213
Sequence CTCTGCTGCACCGCGGCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060474592_1060474602 17 Left 1060474592 9:123977191-123977213 CCGGCAGCCGCGGTGCAGCAGAG No data
Right 1060474602 9:123977231-123977253 GTTGGAGGCAGCCACGCCAGTGG No data
1060474592_1060474601 2 Left 1060474592 9:123977191-123977213 CCGGCAGCCGCGGTGCAGCAGAG No data
Right 1060474601 9:123977216-123977238 ACTGGAGGGAGTGAGGTTGGAGG No data
1060474592_1060474603 18 Left 1060474592 9:123977191-123977213 CCGGCAGCCGCGGTGCAGCAGAG No data
Right 1060474603 9:123977232-123977254 TTGGAGGCAGCCACGCCAGTGGG No data
1060474592_1060474599 -5 Left 1060474592 9:123977191-123977213 CCGGCAGCCGCGGTGCAGCAGAG No data
Right 1060474599 9:123977209-123977231 CAGAGGGACTGGAGGGAGTGAGG No data
1060474592_1060474600 -1 Left 1060474592 9:123977191-123977213 CCGGCAGCCGCGGTGCAGCAGAG No data
Right 1060474600 9:123977213-123977235 GGGACTGGAGGGAGTGAGGTTGG No data
1060474592_1060474605 22 Left 1060474592 9:123977191-123977213 CCGGCAGCCGCGGTGCAGCAGAG No data
Right 1060474605 9:123977236-123977258 AGGCAGCCACGCCAGTGGGGAGG No data
1060474592_1060474604 19 Left 1060474592 9:123977191-123977213 CCGGCAGCCGCGGTGCAGCAGAG No data
Right 1060474604 9:123977233-123977255 TGGAGGCAGCCACGCCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060474592 Original CRISPR CTCTGCTGCACCGCGGCTGC CGG (reversed) Intergenic
No off target data available for this crispr