ID: 1060475803

View in Genome Browser
Species Human (GRCh38)
Location 9:123985667-123985689
Sequence TCTCGTAACCTGCTCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060475803_1060475808 20 Left 1060475803 9:123985667-123985689 CCAGCACAGAGCAGGTTACGAGA No data
Right 1060475808 9:123985710-123985732 TGACCCAGTGGAATGAACAAGGG No data
1060475803_1060475807 19 Left 1060475803 9:123985667-123985689 CCAGCACAGAGCAGGTTACGAGA No data
Right 1060475807 9:123985709-123985731 ATGACCCAGTGGAATGAACAAGG No data
1060475803_1060475806 8 Left 1060475803 9:123985667-123985689 CCAGCACAGAGCAGGTTACGAGA No data
Right 1060475806 9:123985698-123985720 GGAATGAATGAATGACCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060475803 Original CRISPR TCTCGTAACCTGCTCTGTGC TGG (reversed) Intergenic
No off target data available for this crispr