ID: 1060475807

View in Genome Browser
Species Human (GRCh38)
Location 9:123985709-123985731
Sequence ATGACCCAGTGGAATGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060475803_1060475807 19 Left 1060475803 9:123985667-123985689 CCAGCACAGAGCAGGTTACGAGA No data
Right 1060475807 9:123985709-123985731 ATGACCCAGTGGAATGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060475807 Original CRISPR ATGACCCAGTGGAATGAACA AGG Intergenic
No off target data available for this crispr