ID: 1060478961

View in Genome Browser
Species Human (GRCh38)
Location 9:124006557-124006579
Sequence ATGTAGAAACTCCCGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060478961 Original CRISPR ATGTAGAAACTCCCGGAGGA GGG (reversed) Intronic
901171118 1:7258309-7258331 AGCTAGAAACTCCCTGATGAAGG + Intronic
901743046 1:11355034-11355056 ACTTAGAACCTCCCTGAGGACGG + Intergenic
903495196 1:23761591-23761613 ATGTAGATACTCTTGGGGGAGGG - Exonic
904469929 1:30729933-30729955 AGGTAGAAATTCCCAGAGGAAGG + Intergenic
907060440 1:51417620-51417642 GTGTTGGAACTCCCAGAGGAAGG - Intronic
909553873 1:76931060-76931082 AAGGAGAAACTCCAGAAGGATGG - Intronic
914415579 1:147478451-147478473 CTGTAGAAGCTCCGGGAGGAGGG - Intergenic
915406156 1:155661132-155661154 TTGTAGAATCACCCGGAGAAGGG + Intronic
915605354 1:156946976-156946998 ATGAAGAAGCTCCGGGAGGAAGG - Exonic
917520645 1:175745697-175745719 ATGTGCAAACTCATGGAGGAGGG + Intergenic
921700086 1:218259135-218259157 ATGTAGAAACTACCTGACAAAGG + Intergenic
923750669 1:236743441-236743463 ATGTAGAAAATCTGGGAGGGAGG + Intronic
924306964 1:242699299-242699321 AGGTGGAAAATCACGGAGGAAGG + Intergenic
1064257040 10:13751162-13751184 AGGAAGGAACTCCAGGAGGAAGG + Intronic
1067842489 10:49691987-49692009 CTGAAGACACTCCTGGAGGATGG - Intronic
1076165346 10:128277893-128277915 ATGAAGAAACTCACAAAGGAAGG - Intergenic
1082641028 11:55661852-55661874 ATGTACAAAGGCCCAGAGGAGGG - Intergenic
1083841902 11:65309349-65309371 ATGGAGAAACACCCAGAGCAGGG - Intergenic
1084307711 11:68297827-68297849 AAGAAGAAACTCGGGGAGGAGGG - Intergenic
1088925414 11:114296335-114296357 ATGATGAAATTCCCGGAGAAGGG - Intronic
1089765940 11:120765811-120765833 ATGATGAAACTTCCAGAGGAAGG - Intronic
1106180461 13:27365122-27365144 ATTAACAAACTCCAGGAGGAAGG - Intergenic
1110488402 13:76073110-76073132 ATGTAGAATTTCCTGGAGGGTGG + Intergenic
1112182276 13:97095356-97095378 TGGTAGAAACTCCAGGATGAGGG + Intergenic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1112730644 13:102357267-102357289 ATGTAAGATCTCCAGGAGGAAGG + Intronic
1114745414 14:25140853-25140875 CTGAAGAAACTTCTGGAGGAAGG - Intergenic
1120204565 14:81573915-81573937 ATTTAGAAATTCCAGGAGTACGG + Intergenic
1124486031 15:30117491-30117513 ATTTATAAACTCCCGATGGAAGG + Intergenic
1124517544 15:30379778-30379800 ATTTATAAACTCCCGATGGAAGG - Intronic
1124541106 15:30586477-30586499 ATTTATAAACTCCCGATGGAAGG + Intergenic
1124757552 15:32421110-32421132 ATTTATAAACTCCCGATGGAAGG - Intergenic
1124855268 15:33381532-33381554 ATGAAAAAACACCTGGAGGAAGG - Intronic
1132406228 15:101543115-101543137 ATGTAGATATTCCCGGGGGCAGG - Intergenic
1133097893 16:3459555-3459577 ATGTAGAAAATCCCACAAGAAGG - Intronic
1135651924 16:24213862-24213884 ATATAGAAACACCAGCAGGATGG + Intronic
1149848275 17:60020248-60020270 CTGTAGAAACTCACTCAGGAAGG + Intergenic
1149861894 17:60126276-60126298 CTGTAGAAACTCACTCAGGAAGG - Intergenic
1150045767 17:61912012-61912034 ATGAAGAAAGTCTTGGAGGAAGG - Exonic
1150086627 17:62276815-62276837 CTGTAGAAACTCACTCAGGAAGG + Intronic
1151308194 17:73277320-73277342 ATTTAGATCCTCCCAGAGGAGGG - Intergenic
1153323987 18:3799381-3799403 ATGAAGAAACCCCCGCAGAAGGG - Intronic
1155241818 18:23871270-23871292 ATGTAAATACTCCAGGAGGCAGG + Intronic
1157678420 18:49584575-49584597 ATGGAGAAAATGCCAGAGGAGGG - Intronic
1161930094 19:7333650-7333672 ATGTGCAAAGTCCCGGAGGCTGG + Intergenic
1167765333 19:51478798-51478820 ATCAAGAAACTCCCAGAGCAGGG + Intronic
1168208861 19:54874162-54874184 ATGTGGAAATTCCCTGACGAGGG + Intergenic
1168659630 19:58155565-58155587 GTTTTGAAACTCCCTGAGGAGGG + Intergenic
925139621 2:1540853-1540875 AAATAAAACCTCCCGGAGGAAGG - Intronic
926159651 2:10478516-10478538 ATGTACAAACGTTCGGAGGAGGG - Intergenic
926797899 2:16633874-16633896 ATGTGGATACTCCCAGGGGAAGG - Intronic
932067990 2:68587537-68587559 ATGTAGATATTCCCTAAGGAAGG + Intronic
936175335 2:110214800-110214822 ATGTGGAAGTTCCTGGAGGATGG - Intergenic
939218184 2:139267113-139267135 ATGGGGAAACTCCAGGAGGATGG + Intergenic
939843821 2:147220208-147220230 ATGTTGAAACTCCTGGTGGGAGG - Intergenic
939900306 2:147843778-147843800 AAGAAAAAACTCACGGAGGAAGG - Intergenic
944036472 2:195300467-195300489 ATGAATAAACTCTTGGAGGAAGG + Intergenic
944556204 2:200890021-200890043 ATGTAGAAAATGCTGGAGAATGG + Intronic
946449734 2:219769475-219769497 ATGTGCAAGCTCCCGGAGGCAGG + Intergenic
948856634 2:240733283-240733305 ATGGGGAAACTCCCAGAGGCAGG + Intronic
1170244725 20:14207882-14207904 ATGTAGTGAGTCCTGGAGGAAGG + Intronic
1170947481 20:20904302-20904324 CTGGACAAACTCCCTGAGGAAGG - Intergenic
1172483569 20:35285623-35285645 ATGGGGAAACCCCTGGAGGAGGG - Intergenic
1174431530 20:50473412-50473434 TTGGAGAAACTACTGGAGGAAGG + Intergenic
1174707390 20:52670374-52670396 ATGCAGAAATTTCCAGAGGAAGG - Intergenic
1177093654 21:16802633-16802655 TTGTAGAGAATCCCGGAGGATGG + Intergenic
1178285551 21:31322607-31322629 AAGTAGAAACACCCACAGGAGGG - Intronic
1185060446 22:48603693-48603715 ATGTAAAACCTCCAGGAGAAGGG - Intronic
950414024 3:12858138-12858160 AGGTGGAAACCCCAGGAGGAAGG - Intronic
952223973 3:31354924-31354946 ATGTAGAAAGTCCCTGAGATAGG + Intergenic
953312691 3:41894945-41894967 ATTTATAAACTCCCGATGGAAGG - Intronic
954863930 3:53713013-53713035 ATGTAGAATGTCCCAGAGAATGG - Intronic
960064779 3:113359538-113359560 ATGTTGAAACTTCCAGAGCATGG - Intronic
966146941 3:176823203-176823225 ATGTTGAAACTCCAAGTGGAAGG - Intergenic
967922599 3:194624024-194624046 TTGTAGAAACCACCAGAGGATGG - Intronic
969060454 4:4429832-4429854 CTGTAGAAACTCCCAGTGGCTGG - Intronic
970383530 4:15532491-15532513 AACTATAAACTCCCTGAGGATGG + Intronic
979312876 4:119224699-119224721 AGGGAGAAACTCCAGGAGGCTGG + Intronic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
994268876 5:97753171-97753193 ATATAGAAACTCCTAGAGAAAGG + Intergenic
999563150 5:152827074-152827096 ATACAGAAACGCCCAGAGGAAGG - Intergenic
1000116584 5:158159702-158159724 ATGAAGAAACTGCCCAAGGAAGG - Intergenic
1002613033 5:180433764-180433786 CTGGAGAAACGCCTGGAGGAAGG - Intergenic
1004730483 6:18353361-18353383 ATGTATAAACTGATGGAGGAGGG + Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1008086421 6:47249550-47249572 AAGTTGAAGCTCCAGGAGGAAGG + Intronic
1010031636 6:71277235-71277257 ATGTAGAAATTCCAGGAGACAGG + Intergenic
1015740267 6:136446400-136446422 ATGTGGAAACTCCTGGATGGTGG - Intronic
1019803699 7:3107005-3107027 ATGAGGAATCTCCAGGAGGAAGG + Intergenic
1024412685 7:49064065-49064087 TTGTAGAAAAGCCCAGAGGAAGG + Intergenic
1026301793 7:69104215-69104237 ATGAGGTAACTCCTGGAGGATGG - Intergenic
1030781501 7:113606182-113606204 ATGGAGAAATTCCTGGAGGGAGG + Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1043095771 8:75970191-75970213 ATGCAGAAACTCAGGGAGGAGGG - Intergenic
1045650595 8:104338652-104338674 ATGTTGGTACTCCCTGAGGAGGG - Intronic
1050610379 9:7346114-7346136 ATTCAAAAACTCCTGGAGGAAGG - Intergenic
1051253700 9:15189725-15189747 ATTTGGAAACTGCTGGAGGAAGG + Exonic
1053090348 9:35269627-35269649 ATGTGATAACTCCTGGAGGATGG - Intronic
1056859388 9:90165812-90165834 ATGTAGACACTCTCAGATGAAGG - Intergenic
1060478961 9:124006557-124006579 ATGTAGAAACTCCCGGAGGAGGG - Intronic
1062054311 9:134463062-134463084 ATGTAGAATCTTCCAGAGGTGGG - Intergenic
1186030328 X:5361796-5361818 ATGTATAAACTCCCAAAAGAAGG + Intergenic
1187795443 X:22999097-22999119 ATTTAGACACTCCCAGAGGCAGG - Intergenic
1188022261 X:25171817-25171839 ATGTTGGGCCTCCCGGAGGAAGG + Intergenic
1190080601 X:47354336-47354358 ATCAAGAAACACCCGGAGGCCGG - Intergenic
1191629034 X:63300969-63300991 ATGCAAAAACTGTCGGAGGATGG - Intergenic
1199682615 X:150237587-150237609 ATGTAGATACACCCGGATGCAGG + Intergenic