ID: 1060478991

View in Genome Browser
Species Human (GRCh38)
Location 9:124006831-124006853
Sequence TGGGCGTCAGCTGAGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060478991_1060479002 25 Left 1060478991 9:124006831-124006853 CCAACCTGCTCAGCTGACGCCCA 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1060479002 9:124006879-124006901 ATCGCTGCAGGGAGAAGAGGAGG No data
1060478991_1060478999 13 Left 1060478991 9:124006831-124006853 CCAACCTGCTCAGCTGACGCCCA 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1060478999 9:124006867-124006889 AGAATTGTTCAGATCGCTGCAGG No data
1060478991_1060479001 22 Left 1060478991 9:124006831-124006853 CCAACCTGCTCAGCTGACGCCCA 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1060479001 9:124006876-124006898 CAGATCGCTGCAGGGAGAAGAGG No data
1060478991_1060479000 14 Left 1060478991 9:124006831-124006853 CCAACCTGCTCAGCTGACGCCCA 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1060479000 9:124006868-124006890 GAATTGTTCAGATCGCTGCAGGG No data
1060478991_1060479003 28 Left 1060478991 9:124006831-124006853 CCAACCTGCTCAGCTGACGCCCA 0: 1
1: 0
2: 1
3: 19
4: 174
Right 1060479003 9:124006882-124006904 GCTGCAGGGAGAAGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060478991 Original CRISPR TGGGCGTCAGCTGAGCAGGT TGG (reversed) Intronic
900422736 1:2562611-2562633 GGGGCCTCAGCTGGGGAGGTGGG + Intronic
900952802 1:5867442-5867464 GGGCCGTCAGGTGAGGAGGTAGG + Intronic
904428614 1:30447500-30447522 TGGGGGAAAGTTGAGCAGGTTGG + Intergenic
905902079 1:41588391-41588413 TGGGGGTCAGCTGGCCAGGCAGG + Intronic
906215170 1:44034314-44034336 TGGGGGCCTGCTGAGAAGGTGGG + Intergenic
907314974 1:53562561-53562583 TGGGACTCAGCTGAGAGGGTGGG - Intronic
907380783 1:54086168-54086190 TGGGAATCAGGAGAGCAGGTTGG - Intronic
912208789 1:107535999-107536021 TGGGCTTCTGCTCAGGAGGTGGG - Intergenic
912588025 1:110784479-110784501 TTGGGGACAGCTGAACAGGTGGG + Intergenic
912795396 1:112689997-112690019 TGGGCTTCAGCTGTGCAGCCAGG - Exonic
915856716 1:159396646-159396668 TGGGTGTCAGCTGAGTTTGTTGG - Intergenic
915924629 1:160006476-160006498 TGTGCATCTTCTGAGCAGGTGGG - Intergenic
916012383 1:160717933-160717955 TGGAGGTCATCTGAGCTGGTAGG - Intergenic
920048402 1:203148607-203148629 TGGGCACCAGCTGAGGAGGTTGG + Intronic
1063368828 10:5507845-5507867 TGGACTTCAGCCCAGCAGGTAGG - Intergenic
1064370937 10:14751107-14751129 TGGGCCCCAGCTGGGCAGATGGG + Intronic
1067834890 10:49632455-49632477 AGGGCTTCAGCTGAGAGGGTTGG - Intronic
1072059860 10:91798927-91798949 TGGGCCCCGGCTGCGCAGGTGGG - Intronic
1074378273 10:112956922-112956944 TGGGGGTCAGCGGAGAAGGGAGG - Intronic
1074389480 10:113044890-113044912 GGGGAGTCATTTGAGCAGGTTGG + Intronic
1076750059 10:132537984-132538006 GGGGCGTCAGCTGCGCCGGGGGG - Exonic
1087655349 11:100916030-100916052 AAGGAGTCAGCTGTGCAGGTAGG - Intronic
1087990312 11:104740878-104740900 TGGGCATCAGCTTAGGAGCTGGG - Intergenic
1089078698 11:115759500-115759522 TGGGGTTCAGTTGAGCAGGCTGG + Intergenic
1090075218 11:123576300-123576322 TGAGAGGCTGCTGAGCAGGTGGG + Intronic
1091555546 12:1570536-1570558 TCAGCGTCAGCTCAGCAGGCAGG - Intronic
1092105069 12:5915610-5915632 GGTGGGACAGCTGAGCAGGTGGG + Intronic
1093126562 12:15336760-15336782 TGGGCGTAGGCTGACCTGGTGGG - Intronic
1094436813 12:30430072-30430094 GGTGCTTCAGCTGAGCAGATGGG - Intergenic
1099274822 12:80561397-80561419 TGGGCTTCAACAGAGAAGGTAGG + Intronic
1099437337 12:82659853-82659875 TGGAGGTCATCTGAGCTGGTAGG + Intergenic
1101968442 12:109296276-109296298 CGGGGGTCACCTGAACAGGTTGG - Intronic
1105266965 13:18828616-18828638 TGGGAGTCAGCTGAGCTGCTGGG - Intergenic
1105514742 13:21078780-21078802 TGGGAGGCAGCTGAGCATCTGGG + Intergenic
1105902136 13:24764384-24764406 TGGGGGCCAGGTGAGCTGGTGGG + Intronic
1113804320 13:113104461-113104483 TGGGCTTCAGCTGTGCTGGGTGG + Intergenic
1118409367 14:65461777-65461799 GGGGCGGCAGCTGAGAAGATGGG + Intronic
1122267614 14:100554053-100554075 TGGGCTTCAGGGGAGCAGGAAGG - Intronic
1127865843 15:63032037-63032059 TGGGCACCTGCTGAGCTGGTCGG - Intergenic
1129851878 15:78798185-78798207 GGGGGCTCAGCTGAGCAGGACGG - Intronic
1130251119 15:82300906-82300928 GGGGGCTCAGCTGAGCAGGATGG + Intergenic
1132381342 15:101368761-101368783 TGGGCCGGAGCTGAGCAGGTGGG - Intronic
1132700183 16:1218907-1218929 TGGGTGGCAGCTGGGCAGGAAGG + Intronic
1134100402 16:11447901-11447923 GGGGTGTCAGCTGAGCAGAAGGG + Intronic
1134693004 16:16203400-16203422 TGGGACTCACCTGAGCAGCTTGG + Exonic
1134978843 16:18591295-18591317 TGGGACTCACCTGAGCAGCTTGG - Intergenic
1138110375 16:54319083-54319105 CTGGGGTTAGCTGAGCAGGTGGG - Intergenic
1138261925 16:55630015-55630037 TGGAGGTCATCTGAGCTGGTAGG - Intergenic
1140042572 16:71418172-71418194 TGGGCTTCAGCTGAGAGGCTGGG + Intergenic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1145885301 17:28378071-28378093 TGGAGGCCTGCTGAGCAGGTGGG - Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1148486734 17:47995506-47995528 TGGGAGTGAGCCGAGCAGGCCGG + Intergenic
1148656502 17:49287617-49287639 TGTGGGTCAGCTGAGCTGGTGGG + Intergenic
1150429468 17:65103606-65103628 TGGGCATCAGCTTGGCTGGTTGG - Intergenic
1152569577 17:81115823-81115845 TGGCCATCAGCTGAGGAGGGGGG - Intronic
1154327403 18:13401502-13401524 TGAGCGTGAGAGGAGCAGGTTGG + Intronic
1154421445 18:14232821-14232843 TGGGAGTCAGCTGAGCTGCTGGG + Intergenic
1158517115 18:58139822-58139844 GTGGCTACAGCTGAGCAGGTGGG + Intronic
1161344169 19:3759774-3759796 GGGGCCTCTGCTGAGCAGGAGGG - Exonic
1162150234 19:8639835-8639857 TGGGCGGCAGCTGAGCCAGGTGG + Intergenic
1162300416 19:9841877-9841899 TGGGGGTCAGCAGAGCAGCCAGG + Intronic
1162359121 19:10206952-10206974 TGGGCTGCAGCGGAGAAGGTAGG - Intronic
1164087023 19:21912273-21912295 TGGAGGTCATCTGAGCAGGTAGG + Intergenic
1164179605 19:22807360-22807382 GGGGCGGCAGCAGAGCACGTGGG + Intergenic
1165464913 19:35968269-35968291 GGGGCATCAGCTCAGCATGTAGG - Intergenic
1165813758 19:38628419-38628441 TGGGGGTGAGCTGAGAAGCTAGG - Intronic
1167031968 19:46968364-46968386 TGTGGGTCAGCAGAGCAGGAGGG + Intronic
925082642 2:1082060-1082082 TGGGGATCAGCTGAGGATGTTGG + Intronic
925482133 2:4286966-4286988 TTGGCTTCAGCTGAGAAGGCTGG - Intergenic
926094613 2:10073121-10073143 TGGGGGGCAGCGGTGCAGGTGGG + Intronic
927351617 2:22123714-22123736 TGGAGGTCATCTGAGCTGGTAGG - Intergenic
927922661 2:26985462-26985484 TGGGCCACACCTGAGCAAGTGGG - Intronic
930560822 2:52958000-52958022 TGAGGGTCAGGGGAGCAGGTAGG - Intergenic
933949308 2:87314359-87314381 TGGCCATCAGCTGAGAATGTGGG + Intergenic
934104221 2:88681260-88681282 TGGAGGTCATCTGAGCTGGTAGG - Intergenic
934496703 2:94808268-94808290 CGGGAGTCAGCTGAGCTGCTGGG - Intergenic
935696261 2:105773439-105773461 TGGCCCTGAGCTGAGCATGTGGG - Intronic
936330886 2:111547238-111547260 TGGCCATCAGCTGAGAATGTGGG - Intergenic
937048315 2:118865062-118865084 TGAGTGTCCTCTGAGCAGGTAGG + Intergenic
937905486 2:127050926-127050948 TACGGGTCAGCTGAGCAGGGAGG + Intronic
938262856 2:129907481-129907503 TGGGGGGCAGCTGAGCAGCCAGG + Intergenic
941672693 2:168311454-168311476 TGGGCAGCAGCTGTGCAGGGTGG - Intergenic
944850384 2:203713392-203713414 TGGGAGTCAGCTGAAAAGGATGG + Intronic
946018471 2:216622656-216622678 TGGCTGTCAGCTGAGCTGGCTGG - Intergenic
948833947 2:240615240-240615262 TGGGCACCATCTGAGCAGGAGGG - Intronic
1170171630 20:13419818-13419840 GGAGCGTCTGTTGAGCAGGTTGG - Intronic
1171888004 20:30675015-30675037 TGGGAGTCAGCTGAGCTGCTGGG - Intergenic
1172125435 20:32622723-32622745 TGGGCCTCAGCTGCCCGGGTCGG - Intergenic
1172992500 20:39046948-39046970 TGGGCATCATCTGAGTAGGGAGG + Intergenic
1173525270 20:43727511-43727533 TGGGCCTCAGCAGAGCAGAAGGG - Intergenic
1175362790 20:58426811-58426833 TGGGCCTCAGCTGAGATTGTGGG + Intronic
1175761639 20:61565542-61565564 TGGGCCTCAGGTGTGCAAGTGGG - Intronic
1176045556 20:63090932-63090954 AGGGTGTCAGGTGGGCAGGTGGG - Intergenic
1176120901 20:63454194-63454216 TGGGCGGAAGCTGAGCTGGAAGG - Intronic
1176852028 21:13927129-13927151 TGGGAGTCAGCTGAGCTGCTGGG - Intergenic
1178409625 21:32352622-32352644 TGGGCCACAGCTGTGCAGTTGGG - Intronic
1179839678 21:44063282-44063304 TGGGCGGGAGCTGAACAGGTTGG - Intronic
1179925281 21:44530791-44530813 TGGGCATCAGCTCAGCATGGTGG + Intronic
1180056839 21:45363370-45363392 TGGGTGTCCGGTGAGCACGTGGG + Intergenic
1180878434 22:19186407-19186429 TGGGCATCAGCTAGACAGGTTGG - Intronic
1180945114 22:19688467-19688489 TGGGCCTGGGCTGAGCAGGTTGG - Intergenic
1181126383 22:20704219-20704241 TGGCCATCAGGTGAGCAGGGCGG + Intergenic
1181343102 22:22198592-22198614 TGTGCCTCAGCTGGGCAGGGAGG - Intergenic
1181637136 22:24179773-24179795 GGGGCGTCAGCTGAGTAACTGGG - Intergenic
1182151821 22:28032916-28032938 TGGATGTCAGCTGAACAGGCAGG + Intronic
1183564251 22:38601816-38601838 TGGGTGTCAGCTGCTCAGGTGGG + Intronic
1183956419 22:41382763-41382785 GGGGCTTCTGCTGAGCGGGTGGG + Intronic
1184103490 22:42353986-42354008 AGGGCCTCAGCTGAGCCTGTAGG + Intergenic
1184390910 22:44202671-44202693 AGGTCGTCAGCTGAGGAGGGCGG + Intronic
949537189 3:5005089-5005111 TGGGAGTGAGGTGAGCAGGCAGG - Intergenic
950173629 3:10856366-10856388 TGTGCCTCAGCTCAGCAGGAAGG - Intronic
952205161 3:31173906-31173928 TGGGCCTCAGCAGAGCAGTGAGG + Intergenic
953990059 3:47476772-47476794 TGGGCCAGAGCTGGGCAGGTGGG - Intronic
958460106 3:94383686-94383708 TGGGTGGCAGCAGAGCAGTTGGG - Intergenic
961533486 3:127554829-127554851 TGGGCTGCAGATGAGCAGATGGG - Intergenic
961824066 3:129589650-129589672 TGGGCCTCAGCTGAGCACTGAGG - Intronic
962313093 3:134339644-134339666 TGGGCGGCTGCTGAGGAGCTGGG - Intergenic
968351117 3:198053321-198053343 CGGGAGTCAGCTGAGCTGCTGGG - Intergenic
968486865 4:867083-867105 AAGGAGGCAGCTGAGCAGGTCGG + Exonic
969428524 4:7139619-7139641 TGGGCCTCAGAAGAGCAGGGAGG - Intergenic
983262830 4:165475380-165475402 TGGAGGTCATCTGAGCTGGTAGG + Intronic
985774576 5:1834080-1834102 TGGGCGTCTGCAGAGCTGGCAGG + Intergenic
991677412 5:69101667-69101689 TGGGAGTCAGCTGGGCACGGTGG + Intronic
993042097 5:82825841-82825863 TGGGTGGAAGCTGAGCAGGAAGG - Intergenic
993544020 5:89188939-89188961 TGGTTCTCAGCTGAGGAGGTGGG + Intergenic
995842715 5:116459098-116459120 TGGGGTTCAGCTGAGCACGGTGG - Intronic
996496487 5:124162812-124162834 TGCACGTCAGCTGTGCAGGCAGG + Intergenic
1000251830 5:159503186-159503208 GGGGATTCAGCTGAGCAGCTGGG - Intergenic
1001407511 5:171486303-171486325 TGGGTGGAAGCTGAGGAGGTGGG + Intergenic
1002066939 5:176656618-176656640 TGGGCGTGAGCTTGGCAGGCTGG + Intronic
1002288786 5:178184184-178184206 TGGGCGTCAGCCGGGCATGGTGG - Intergenic
1002435827 5:179230198-179230220 TGGGCGTGAGGTGGGCAGGCAGG + Intronic
1002506341 5:179681700-179681722 AGGGCGCCAGCTGAGGAGGGAGG + Intronic
1002571072 5:180139702-180139724 GGGGAGGCGGCTGAGCAGGTGGG + Intronic
1003463759 6:6357192-6357214 TTGGTCTCAGCTGAGCAGGTGGG + Intergenic
1003635727 6:7829743-7829765 TGGGCGTCTGCAGAGCATTTTGG + Intronic
1006611338 6:35296176-35296198 TTGCCCACAGCTGAGCAGGTGGG + Intergenic
1010653792 6:78487632-78487654 TTGGCTTCAGCTGAGTAAGTTGG - Intergenic
1010722861 6:79303550-79303572 TGGGTCTCAGCTGAGCAGGTTGG + Intergenic
1014561292 6:122893978-122894000 TCAGGGTCAGCTGAGCAGGGTGG - Intergenic
1014767353 6:125422095-125422117 TGGGAGTCGCCTGAGCAGGCGGG - Intergenic
1017824558 6:158071823-158071845 TGGGACTGAGCTGAGCAGGGAGG - Intronic
1019703063 7:2483601-2483623 TGGGAGCCAGCTGAGCAGGATGG + Intergenic
1019729359 7:2622015-2622037 GGGGCTGCAGCTGAGCAGGTGGG + Intergenic
1021287993 7:18805989-18806011 TGTGGGTCAGCTGAGGAGTTGGG + Intronic
1021513224 7:21456428-21456450 TGGAGGTCATCTGAGCTGGTAGG + Intronic
1024533203 7:50409921-50409943 TGGGCCTGGGCTGAGCAGATGGG + Intergenic
1025264260 7:57442175-57442197 TGGGAGACAGAAGAGCAGGTGGG - Intergenic
1025898483 7:65725089-65725111 TGAGTGTCAGCTGAGCAGAAGGG - Intergenic
1027009051 7:74725986-74726008 TGGGCCTCAGCTGTGAAGTTTGG + Intronic
1029735535 7:102463993-102464015 GGTGCATCAGCTGAGCAGGCTGG - Intronic
1032062868 7:128739364-128739386 CGCGCGTGAGCTGAGCCGGTGGG + Exonic
1035371676 7:158383139-158383161 TGGACGTTAGCTCAGGAGGTGGG - Intronic
1037561988 8:20083578-20083600 TGGGCCTCAGCTGGGATGGTTGG - Intergenic
1038789972 8:30659430-30659452 TGGGTGTCAGATGATCAAGTAGG - Intergenic
1039862375 8:41469721-41469743 AGAAGGTCAGCTGAGCAGGTCGG - Intergenic
1040477548 8:47793340-47793362 TGGGCCTCAGCTGGGCATGGTGG + Intronic
1042485124 8:69339333-69339355 TGAGGGGCTGCTGAGCAGGTGGG - Intergenic
1048479845 8:134778973-134778995 AGGGAATCAGCTTAGCAGGTGGG + Intergenic
1049037475 8:140087641-140087663 AGGGCGGCAGCAGAGGAGGTTGG - Intronic
1049397317 8:142407136-142407158 TGAGCCTCAGATCAGCAGGTGGG + Intergenic
1049479883 8:142816905-142816927 GGGGCGTCTGCAGAGCAGATGGG - Intergenic
1049573538 8:143380360-143380382 TGGGCAGCCTCTGAGCAGGTGGG + Intronic
1049606672 8:143532817-143532839 AGGGCGTCTGCTGAGGAGATGGG - Intronic
1049623418 8:143609453-143609475 AGGGCCTCATCAGAGCAGGTGGG - Exonic
1049805177 8:144535570-144535592 AGGGCCTCAGCTCAGCAGCTGGG + Intronic
1051484144 9:17589995-17590017 TTGGTGTCAGTTGAGCAGCTTGG + Intronic
1051829098 9:21256141-21256163 TGGAGGTCATCTGAGCTGGTAGG - Intergenic
1052875311 9:33556138-33556160 TGGGAGTCAGCTGAGCTGCTGGG + Intronic
1053500704 9:38588213-38588235 TGGAAGTCAGCTGAGCTGCTGGG - Intergenic
1053660451 9:40272181-40272203 TGGGAGTCAGCTGAGCTGCTGGG + Intronic
1053910823 9:42901534-42901556 CGGGAGTCAGCTGAGCTGCTGGG + Intergenic
1054372569 9:64418404-64418426 TGGGAGTCAGCTGAGCTGCTGGG + Intergenic
1054524161 9:66104108-66104130 TGGGAGTCAGCTGAGCTGCTGGG - Intergenic
1054680197 9:67908173-67908195 TGGGAGTCAGCTGAGCTGCTGGG + Intergenic
1057422565 9:94924158-94924180 TGGGCCACAGCACAGCAGGTGGG + Exonic
1057680102 9:97172613-97172635 TTGGAGTCAGCTGAGCTGCTGGG - Intergenic
1058634696 9:107025007-107025029 TGTGTCTCAGCTCAGCAGGTAGG + Intergenic
1060478991 9:124006831-124006853 TGGGCGTCAGCTGAGCAGGTTGG - Intronic
1060889264 9:127177790-127177812 TGGAAGTCAGCTGGGCAGCTAGG + Intronic
1061042694 9:128149132-128149154 TGGGATCCAGCTGAGCAGGGGGG + Exonic
1062163280 9:135091989-135092011 TGGGCGTCAGCTCAGGAGTATGG + Intronic
1062188223 9:135229885-135229907 TGGACGTGAGCTGTGCAGCTGGG - Intergenic
1062271473 9:135711756-135711778 TGGGCCTCAGCTGAGCGGAGGGG + Intronic
1062347787 9:136123314-136123336 AGGGCGCGTGCTGAGCAGGTGGG + Intergenic
1062590894 9:137274178-137274200 GAGGCCACAGCTGAGCAGGTTGG + Intergenic
1203692904 Un_GL000214v1:63018-63040 CGGGAGTCAGCTGAGCTGCTGGG - Intergenic
1203557089 Un_KI270744v1:9912-9934 CGGGAGTCAGCTGAGCTGCTGGG - Intergenic
1203643391 Un_KI270751v1:41173-41195 CGGGAGTCAGCTGAGCTGCTGGG + Intergenic
1193732233 X:85115477-85115499 TGGAGGTCATCTGAGCTGGTAGG + Intergenic
1194142536 X:90222845-90222867 AGGGCGTCCCCTGAGAAGGTGGG + Intergenic
1199259212 X:145751210-145751232 TGGCAGACAACTGAGCAGGTTGG + Intergenic
1199996842 X:153031035-153031057 TGGGCGTCTGCTGGGCGCGTGGG - Intergenic
1200044932 X:153396404-153396426 TGGGCGTCTGCTGGGCGCGTGGG + Intergenic