ID: 1060479946

View in Genome Browser
Species Human (GRCh38)
Location 9:124012092-124012114
Sequence GCGCCAAAGCCAGGGTCACA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060479946_1060479958 24 Left 1060479946 9:124012092-124012114 CCTTGTGACCCTGGCTTTGGCGC 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1060479958 9:124012139-124012161 AGCTGCCCCTGCGCCTCGGCGGG 0: 1
1: 0
2: 1
3: 25
4: 236
1060479946_1060479956 20 Left 1060479946 9:124012092-124012114 CCTTGTGACCCTGGCTTTGGCGC 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1060479956 9:124012135-124012157 ATGTAGCTGCCCCTGCGCCTCGG 0: 1
1: 0
2: 1
3: 5
4: 155
1060479946_1060479959 27 Left 1060479946 9:124012092-124012114 CCTTGTGACCCTGGCTTTGGCGC 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1060479959 9:124012142-124012164 TGCCCCTGCGCCTCGGCGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 144
1060479946_1060479957 23 Left 1060479946 9:124012092-124012114 CCTTGTGACCCTGGCTTTGGCGC 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1060479957 9:124012138-124012160 TAGCTGCCCCTGCGCCTCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060479946 Original CRISPR GCGCCAAAGCCAGGGTCACA AGG (reversed) Exonic
900399236 1:2466258-2466280 TCGGCACAGCCAGGGTCCCAGGG - Intronic
903534950 1:24060661-24060683 GCCCCAAACCCAGAGGCACATGG - Intronic
905640322 1:39584981-39585003 GCGCCACAGACAGGGTCTCCAGG + Intergenic
907181154 1:52571484-52571506 GCGCTACAGCCTGGGTGACAGGG - Intergenic
912384618 1:109265095-109265117 GATCCACAGCCAGGGTCAGAAGG + Intronic
916077000 1:161206903-161206925 GCGTCAAAGCCAGTGTCCCTAGG + Intronic
916354967 1:163894869-163894891 GCCCAAAATCCAGGGTCACCAGG + Intergenic
916637681 1:166691306-166691328 GCTCCAAAGCCAGACTGACATGG + Intergenic
920690014 1:208138990-208139012 GCACCACAGCCTGGGTGACAGGG + Intronic
1063185067 10:3643112-3643134 GCACCACAGCCTGGGTGACAGGG + Intergenic
1063951190 10:11224905-11224927 GAGCCAAGGCCAGGATCAGAGGG + Intronic
1065499768 10:26368001-26368023 GCACCAAGGACAGGGGCACACGG + Intergenic
1066029449 10:31404877-31404899 GAACCAAAGTCAAGGTCACAGGG + Intronic
1068046365 10:51891227-51891249 GCACCCAAGCCAGGGTGACAGGG + Intronic
1068130711 10:52891484-52891506 GCCCCAAATCAAGAGTCACAAGG + Intergenic
1070306884 10:75245031-75245053 GCCCCAGGGCCAGGGTCACAGGG + Intergenic
1073584017 10:104691529-104691551 TCCCCAGAGCCAGGGTCAAATGG - Intronic
1074185036 10:111093733-111093755 GCCTCAAAGTCAGGGTCACTTGG + Intergenic
1075564896 10:123496014-123496036 GCATCAATGCCAGGGTCAGAAGG + Intergenic
1077441516 11:2571268-2571290 TCGCCACAGCCAGGGCCCCAGGG - Intronic
1080913288 11:36627436-36627458 GAGCCAAACCCAGGATCACAAGG - Intronic
1083383480 11:62288577-62288599 GAACCAAAGCCAGGTTCTCATGG + Intergenic
1084193833 11:67512131-67512153 GCGCTCAAGCCTGGGTGACAGGG - Intergenic
1090060149 11:123457650-123457672 GCACCAGAGCCAGGCTCATAAGG - Intergenic
1090719782 11:129460567-129460589 GGGCCAGAGCCAGGGCCCCAAGG - Intergenic
1092243074 12:6847275-6847297 GTGCCAGAGCCATAGTCACAGGG - Exonic
1092439241 12:8483295-8483317 GTGGCAGAGCCTGGGTCACATGG + Intergenic
1094842510 12:34348009-34348031 GGCCCAAACCCAGGATCACAGGG + Intergenic
1094845766 12:34360764-34360786 GGGCCAAATCCAGGGTCCCCTGG + Intergenic
1097044035 12:56173861-56173883 GAGGCAGAGACAGGGTCACACGG + Intronic
1101719761 12:107341278-107341300 GGGACAAAGCCTGTGTCACAAGG - Intronic
1102575146 12:113851458-113851480 GGGCCAATGCCAGGGACCCAAGG + Intronic
1102802734 12:115750748-115750770 AGGCCTAAGCCAGGGTCAGAGGG - Intergenic
1103904305 12:124319704-124319726 GAGCCAAAGGCAGGGTCAGGAGG + Intergenic
1104672036 12:130687173-130687195 CCGCCAAAGCCATGTTCAAAGGG + Intronic
1111390128 13:87583101-87583123 GGGCCACAGCAAGGGTCCCATGG - Intergenic
1117926042 14:60779962-60779984 GCGCCATGGCCAGGGACACATGG - Intronic
1117993502 14:61457789-61457811 GCTCCCAAGGCAGGGTCATATGG + Intronic
1121029617 14:90646690-90646712 GGGCCCAAGCTAGGGTCAGATGG - Intronic
1121775603 14:96588566-96588588 GCGGCAAAGTCAGGGTCATTGGG - Intergenic
1122622973 14:103070293-103070315 GAACCAATGGCAGGGTCACATGG - Intergenic
1123500472 15:20877427-20877449 GACGGAAAGCCAGGGTCACATGG - Intergenic
1123557717 15:21451120-21451142 GACGGAAAGCCAGGGTCACATGG - Intergenic
1123593944 15:21888401-21888423 GACGGAAAGCCAGGGTCACATGG - Intergenic
1126602049 15:50438548-50438570 GCACTACAGCCAGGGTGACAGGG + Intronic
1127781742 15:62322653-62322675 GCACCCCAGCCAGGGTGACAGGG - Intergenic
1127880348 15:63151821-63151843 GCTCCAAACCCAGCTTCACAAGG - Exonic
1131341876 15:91609991-91610013 TCGCCAAAGCCAGGGACAAACGG - Intergenic
1131910060 15:97188538-97188560 TGACCAAAGCCAGGGTCATAAGG + Intergenic
1202966069 15_KI270727v1_random:178292-178314 GACGGAAAGCCAGGGTCACATGG - Intergenic
1137405315 16:48184511-48184533 GGGCAACAGCCAAGGTCACAAGG + Exonic
1139705609 16:68738327-68738349 GCGTCAAAGCCAGGGTGGCAGGG - Exonic
1139895281 16:70283628-70283650 GCCCCAAAGTCAGGGTCTCTAGG + Intronic
1141230531 16:82162986-82163008 GTGCCAGGGGCAGGGTCACAGGG - Intronic
1141824352 16:86468552-86468574 CCGCTCAAGCCAGGATCACAAGG + Intergenic
1142196031 16:88739711-88739733 GCTCCGAGGCCAGGGTAACAGGG + Intronic
1144621904 17:16823323-16823345 GCGCCAAGCCCTGGGTCACGGGG - Intergenic
1144884519 17:18449391-18449413 GCGCCAAGCCCTGGGTCACGGGG + Intergenic
1145093274 17:20003361-20003383 GCACCACAGCCTGGGTGACAGGG + Intergenic
1145147710 17:20494986-20495008 GCGCCAAGCCCTGGGTCACGGGG - Intergenic
1145945977 17:28774905-28774927 GCACTCCAGCCAGGGTCACAGGG + Intronic
1147912884 17:43867451-43867473 TTGCCTAATCCAGGGTCACAAGG + Intergenic
1148074688 17:44928510-44928532 TCGCCATAGTCCGGGTCACAGGG + Exonic
1148584892 17:48770549-48770571 GCGCTCCAGCCAGGGTGACAGGG - Intronic
1149640453 17:58199357-58199379 GTGACACAGACAGGGTCACACGG - Intronic
1150803578 17:68301300-68301322 GGGCAAAAGCCTGGGACACAAGG + Intronic
1156290246 18:35742508-35742530 TTGCCAAACCCAAGGTCACAAGG + Intergenic
1156341175 18:36211927-36211949 GCTCCAAAGCTAGTGTCCCAGGG - Intronic
1160765238 19:804675-804697 GCAGCACATCCAGGGTCACAGGG - Exonic
1166094043 19:40528882-40528904 GGGGCAAAGCCAGGGACGCAGGG - Intronic
1166719176 19:44987686-44987708 GAGCCAGGGCCAGGGACACAAGG - Intronic
1167353406 19:48989858-48989880 GAACCAAAGCCATGGTCTCAGGG - Intronic
1168355288 19:55696384-55696406 GCCCCACAGCCAGGGCCTCAGGG + Intronic
925035265 2:680204-680226 GAGCCACAGCCAGGCTGACATGG + Intergenic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
926771100 2:16376079-16376101 GCACCTAAACCAGAGTCACATGG + Intergenic
927464899 2:23329520-23329542 CAGACAAAGACAGGGTCACAGGG - Intergenic
930050529 2:47212306-47212328 TTGCCAAATCCATGGTCACAAGG - Intergenic
933784210 2:85825751-85825773 GTGCCAAATCCAGGGTCATAAGG + Intergenic
937069864 2:119054830-119054852 GGGCAAAAGCAAGGATCACAAGG + Intergenic
947797223 2:232902045-232902067 GAGCCAGAGCCAGGGGCGCAGGG + Intronic
947898449 2:233698095-233698117 GCACCAGATACAGGGTCACAGGG - Intronic
947907978 2:233779592-233779614 GAGGCAAGGCCAGGGACACAAGG + Intronic
948925644 2:241095105-241095127 GGGCTGAAGCCAGGGCCACAGGG - Exonic
1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG + Intergenic
1176709899 21:10141489-10141511 GCACTACAGCCTGGGTCACAGGG - Intergenic
1177087551 21:16725682-16725704 GCACCAAAGAAAGGGGCACAGGG + Intergenic
1178387253 21:32162835-32162857 CCTCCAAAGCCAGGGGCACATGG + Intergenic
1179003589 21:37487230-37487252 GCCCCATACCCAGGGTCATAGGG + Intronic
1179655984 21:42845011-42845033 GGGCCCAGCCCAGGGTCACACGG + Intronic
1180057240 21:45365265-45365287 GCGGCCAAGCCAGCGTCACCGGG + Intergenic
1180057247 21:45365297-45365319 GCGGCCAAGCCAGCGTCACCGGG + Intergenic
1181821318 22:25477857-25477879 GGGCCAAACCCAGGGTCAATAGG + Intergenic
1184161628 22:42700626-42700648 ACACCAGCGCCAGGGTCACACGG + Intronic
1184409944 22:44320665-44320687 GGGCCAAAGAGGGGGTCACAGGG - Intergenic
1184418021 22:44363433-44363455 GCTCCTAAGCCAGTGACACAGGG - Intergenic
1185026592 22:48417663-48417685 CCATCAAAGGCAGGGTCACATGG - Intergenic
949918755 3:8985417-8985439 CCTCCAAGGCCAGGGTCACTGGG + Exonic
953141776 3:40235760-40235782 GCCTCAGAGTCAGGGTCACAGGG + Intronic
953879412 3:46683901-46683923 GGGCCCAAGCCAGAGTCCCAGGG + Intronic
955429857 3:58831665-58831687 GCTGCAAAGCCAGGGACTCACGG + Exonic
955753939 3:62209019-62209041 GCGCCAAAGCCAGCATCACATGG - Intronic
960573018 3:119203998-119204020 GCACCAAATCCAGAGTCACTCGG - Exonic
965259539 3:166463435-166463457 GGGCCAAAGCCAGAGACTCAGGG + Intergenic
967355463 3:188564961-188564983 GAGCAAAAGCCAGAGACACACGG - Intronic
969908100 4:10416495-10416517 GAGCCAAAGCAAAGTTCACAAGG - Intergenic
970151264 4:13093086-13093108 GCACCACAGCCAGGCTAACAGGG + Intergenic
978401522 4:108335836-108335858 GAGCCACAGCCAGTGTCAGAGGG + Intergenic
980368425 4:131837131-131837153 GAGCCAAAGCCAGGCTGCCATGG + Intergenic
981092331 4:140744597-140744619 GAGCCACAGCCAGGGCCCCAAGG - Intronic
981508351 4:145527893-145527915 GCACTACAGCCAGGGTGACAGGG - Intronic
985618415 5:938403-938425 ACCCCAAAGCCAGGGCCACTGGG - Intergenic
985802374 5:2013155-2013177 GCGCTCACCCCAGGGTCACAGGG - Intergenic
985823981 5:2179488-2179510 AAGCCAAAGCCAGGATCACAGGG + Intergenic
986608240 5:9544758-9544780 CCGCCAAAGCCAGGGGAACAGGG + Intronic
988004917 5:25397180-25397202 GAGCCAGAGACAGGATCACATGG + Intergenic
989677902 5:43993841-43993863 GCGTTAAAGCCAAGGTCAAATGG + Intergenic
990733433 5:58834230-58834252 GCACCAAAGCCAGAGAAACATGG + Intronic
1001984306 5:176061000-176061022 GCGCCGAAGCCAGGCTCATCCGG + Intronic
1002233170 5:177783065-177783087 GCGCCGAAGCCAGGCTCATCCGG - Intronic
1002278580 5:178118287-178118309 GGGCCACAGCCAGGGTCAACAGG - Intronic
1006254020 6:32814979-32815001 GAGCCATGGCCAGGTTCACATGG + Intronic
1006340836 6:33446136-33446158 GAGCCAAGGAGAGGGTCACATGG + Intronic
1006583849 6:35092587-35092609 GCGCCATAGCCAGGGAGCCAAGG - Intergenic
1010805597 6:80231928-80231950 GCACTCCAGCCAGGGTCACAGGG + Intronic
1012908919 6:105097630-105097652 GCCCCAAAGACAGAGTCACTTGG - Exonic
1016417746 6:143850931-143850953 GCACCAAACCCAGCATCACAGGG + Intronic
1019449579 7:1090404-1090426 GCGGCAGAGCCGGGGTGACACGG + Intronic
1019449626 7:1090550-1090572 GCGGCAGAGCCGGGGTGACACGG + Intronic
1019449640 7:1090598-1090620 GCGGCAGAGCCAGGGTGACACGG + Intronic
1019591594 7:1838299-1838321 GCGGAAGTGCCAGGGTCACATGG - Intronic
1020105462 7:5420500-5420522 GCCCCGAGGCCAGGGTCCCAAGG + Intronic
1025604415 7:63029124-63029146 GGGCCAAAGCAAGGGCCATAAGG - Intergenic
1029124249 7:98286039-98286061 CCCCCAAAGGCAGTGTCACAGGG - Intronic
1030105372 7:105982572-105982594 GGGCCAGAGGCTGGGTCACAGGG - Intronic
1033171765 7:139091020-139091042 GCCAGGAAGCCAGGGTCACAGGG - Intronic
1034677142 7:152900064-152900086 GCTTCAGAGCCAGGGTCAGATGG + Intergenic
1036700051 8:11007403-11007425 GCAGCAAAGCCTGGGTCTCAAGG + Intronic
1043204540 8:77420532-77420554 GAGCCAAAGCCTGGCTGACATGG - Intergenic
1045721765 8:105119840-105119862 GTGAGAAAGCCAAGGTCACATGG - Intronic
1047511948 8:125522128-125522150 GAGCCAAAACCAGGGTGAGAAGG - Intergenic
1048836747 8:138525912-138525934 GCACCATAGCCTGGGTGACAGGG + Intergenic
1049329234 8:142041239-142041261 GGCACAAAGCCATGGTCACATGG + Intergenic
1050635399 9:7607062-7607084 GTGCCACACCCAGGATCACATGG - Intergenic
1050853291 9:10317096-10317118 GCTCAATAGCCAGTGTCACAAGG - Intronic
1053283558 9:36836705-36836727 GTGCCCAAGCCAGGGCCACCAGG - Exonic
1053632790 9:39962846-39962868 GAGCCAAAGCCAGGCTGCCACGG + Intergenic
1053772968 9:41500687-41500709 GAGCCAAAGCCAGGCTGCCACGG - Intergenic
1054211098 9:62287851-62287873 GAGCCAAAGCCAGGCTGCCACGG - Intergenic
1055093086 9:72382744-72382766 TCTCCAAGGCGAGGGTCACAGGG + Intergenic
1060479946 9:124012092-124012114 GCGCCAAAGCCAGGGTCACAAGG - Exonic
1060973642 9:127753014-127753036 GCGGCAAAGTCAGGGTCCTACGG + Intronic
1062238410 9:135523534-135523556 GAGCCACAGCCAGGGCTACAGGG - Intronic
1062447581 9:136602115-136602137 GCCCCAAAGCCAGGGTCGAATGG + Intergenic
1202794662 9_KI270719v1_random:110486-110508 GCACTACAGCCTGGGTCACAGGG - Intergenic
1186626964 X:11304707-11304729 GTGCCAATGCCAGAGTGACAAGG - Intronic
1188370958 X:29369153-29369175 GCTCCACAGCCAAGGCCACAGGG - Intronic
1190407958 X:50106249-50106271 GCGCCAGATCCAGGGCCACTTGG - Intergenic
1196819625 X:119692696-119692718 GCGGCAAGGCCAGGGTGCCAGGG + Intronic