ID: 1060480002

View in Genome Browser
Species Human (GRCh38)
Location 9:124012259-124012281
Sequence CCTGGCGCTCCTGGCGCTAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 102}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060480002_1060480007 -10 Left 1060480002 9:124012259-124012281 CCGTTAGCGCCAGGAGCGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1060480007 9:124012272-124012294 GAGCGCCAGGCAGCTGAGGCGGG 0: 1
1: 0
2: 1
3: 32
4: 417
1060480002_1060480009 -8 Left 1060480002 9:124012259-124012281 CCGTTAGCGCCAGGAGCGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1060480009 9:124012274-124012296 GCGCCAGGCAGCTGAGGCGGGGG 0: 1
1: 0
2: 1
3: 26
4: 360
1060480002_1060480010 -7 Left 1060480002 9:124012259-124012281 CCGTTAGCGCCAGGAGCGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1060480010 9:124012275-124012297 CGCCAGGCAGCTGAGGCGGGGGG 0: 1
1: 0
2: 6
3: 65
4: 998
1060480002_1060480012 8 Left 1060480002 9:124012259-124012281 CCGTTAGCGCCAGGAGCGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1060480012 9:124012290-124012312 GCGGGGGGCAAGCCCTCCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 127
1060480002_1060480018 25 Left 1060480002 9:124012259-124012281 CCGTTAGCGCCAGGAGCGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1060480018 9:124012307-124012329 CCTCGGAGGAGCCGCGCCCCCGG 0: 1
1: 0
2: 1
3: 15
4: 182
1060480002_1060480008 -9 Left 1060480002 9:124012259-124012281 CCGTTAGCGCCAGGAGCGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1060480008 9:124012273-124012295 AGCGCCAGGCAGCTGAGGCGGGG 0: 1
1: 0
2: 2
3: 14
4: 219
1060480002_1060480013 11 Left 1060480002 9:124012259-124012281 CCGTTAGCGCCAGGAGCGCCAGG 0: 1
1: 0
2: 0
3: 11
4: 102
Right 1060480013 9:124012293-124012315 GGGGGCAAGCCCTCCCTCGGAGG 0: 1
1: 0
2: 1
3: 15
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060480002 Original CRISPR CCTGGCGCTCCTGGCGCTAA CGG (reversed) Exonic
900652309 1:3735708-3735730 GCTGGCACTCCTGGGGCCAAGGG + Exonic
901202117 1:7472895-7472917 CCAGGCGGTCCTGGCCCCAAAGG + Intronic
903886045 1:26541813-26541835 CCTGCCAATCCTGGCCCTAACGG - Intronic
904253682 1:29241161-29241183 CCTGGGGAGCCTGGTGCTAAGGG + Intronic
904696511 1:32334719-32334741 CCTGGGGTTCCTGGCTCTCAGGG + Exonic
905204626 1:36336266-36336288 CCTGGCCCTCCTGGCCCCTATGG + Intergenic
908401237 1:63774447-63774469 CCCGCCGCTCCTGGCGCTGCTGG + Exonic
910188801 1:84574322-84574344 GCTGGCGCTGCTGGCGCTGCTGG - Exonic
910943093 1:92558197-92558219 CCTGGCTCTCTTGACCCTAAAGG + Intronic
911861945 1:102962696-102962718 CCTGGCCCTCCTGGCCCTCCTGG - Exonic
915331938 1:155118058-155118080 CCTGGCTCTCCTGGGGATAAAGG - Intergenic
921711618 1:218378688-218378710 CCTGGAACTCCTGGCCCCAAAGG + Intronic
922500755 1:226095355-226095377 CCTTGCCCTCCTGGAGCTGATGG - Intergenic
923490250 1:234478306-234478328 CCCGGCGCTGCTGGCGCTTCTGG - Exonic
1071312654 10:84357787-84357809 CCTTGCACTCCTAGAGCTAATGG - Intronic
1072670742 10:97427115-97427137 CCAACCGCTTCTGGCGCTAAGGG - Intronic
1073390936 10:103175962-103175984 CTTGGGGCTCCTGGCTCTCAGGG - Intronic
1078336275 11:10465848-10465870 GCTGGCGCTCCAGGCGCCACTGG - Intronic
1080362790 11:31535424-31535446 CCTGGAGCTCTTGGGGCCAAGGG + Intronic
1083612211 11:64009718-64009740 CCAGGGGCTGCTGGGGCTAAAGG - Intronic
1083755419 11:64789415-64789437 CCTGGCCCTGCTGGGGCTGAAGG - Exonic
1087297044 11:96389776-96389798 GCTCGCGCTCCCGGTGCTAATGG - Intronic
1088604167 11:111512671-111512693 CCTGGCACTCCTGGGGGTCATGG + Intergenic
1089519571 11:119054942-119054964 CCTGGGGAGCCTGGCCCTAAGGG + Intronic
1089567148 11:119377839-119377861 CCAGGCGCTCCTGGCCCTGGGGG + Intronic
1090113741 11:123943742-123943764 CCTGGTGTTCCTGGGGTTAATGG - Exonic
1095687245 12:45050515-45050537 GCTGGCTCACCTGGCGCTGAAGG + Exonic
1095982618 12:47981783-47981805 CCTGGCCCAGCTGGTGCTAATGG - Exonic
1095982881 12:47982855-47982877 CCCGGCACTCCTGGCACTGATGG - Exonic
1097057471 12:56258445-56258467 CCCGGCGCTCCCCGCGCAAACGG + Intergenic
1101872425 12:108577108-108577130 CCTGGAGCTGCTGGTGCAAAGGG + Intergenic
1103050962 12:117779094-117779116 CCTGGCACACCTGGCTCTGAAGG - Intronic
1117072587 14:52069552-52069574 CCGGGCGCTCCTGGCTCTGGAGG + Intergenic
1122090322 14:99334192-99334214 CCTGGAGCTCCTGGCGCTCCTGG + Intergenic
1132751333 16:1459244-1459266 CCTGGGGCTCCTGGGGCTGAGGG - Intronic
1132846878 16:2004789-2004811 CCTGGCGCTCCTGACCCTCCTGG - Intronic
1133839124 16:9393068-9393090 CCTGGAGCTCCAGGCCCTCATGG - Intergenic
1134067256 16:11236801-11236823 CCTGGCACTCCAGTCCCTAAGGG - Intergenic
1136557348 16:31015340-31015362 CTTGGCCCTCCTGACGCTAGAGG + Intergenic
1143637769 17:8176229-8176251 CCTGACGCTCCTGGCGCATCTGG - Exonic
1148793995 17:50188582-50188604 CCTGGTGCTCCTGGTGCTCCTGG - Exonic
1148794202 17:50189402-50189424 CCTGGCCCTGCTGGCGAGAAAGG - Exonic
1148794370 17:50190053-50190075 CCTGGTGATGCTGGTGCTAAAGG - Exonic
1148795372 17:50194401-50194423 CCTGGCCCTGCTGGCCCCAAAGG - Exonic
1148795553 17:50195072-50195094 CCTGGTGCTCCTGGCAGCAAAGG - Exonic
1150593313 17:66581974-66581996 CATGGCTCTCCTGGGGCTAATGG - Intronic
1151727624 17:75893829-75893851 CCTGGCTCCCCTGGTGCTACTGG + Intronic
1158649548 18:59273419-59273441 GCTGGGGCTCTCGGCGCTAAAGG + Intronic
1165941528 19:39416895-39416917 CCTGGCGCTCCTGCAGCCACAGG - Exonic
1166748492 19:45153392-45153414 CCTGGGGCTGCTGGCGCTGCTGG - Exonic
1167438872 19:49496654-49496676 CTGGGGGCTCCTGGCGTTAATGG + Intronic
1167787782 19:51649984-51650006 CCTGGCGCTCCTGTGAGTAAGGG - Intergenic
925583990 2:5444355-5444377 CCTGGCTCGCCTGGAGCTAGCGG + Intergenic
928091410 2:28377228-28377250 CCTGGCCCTCCTGACGGTGAGGG + Intergenic
929789017 2:45010374-45010396 CCTGGCGCTCCTCGGGCTGTGGG - Intergenic
934466223 2:94265489-94265511 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
937356728 2:121202501-121202523 CCTGGCCCTCATGGCCCTCATGG - Intergenic
943525084 2:189006369-189006391 CCTGGTGCCCCTGGCGCTCCTGG + Exonic
946425976 2:219597210-219597232 ACTGGCAGTCCTGGCGCTACTGG + Intergenic
947167549 2:227277532-227277554 CCTGGGCCTCCTGGACCTAAGGG + Exonic
1170226262 20:13995148-13995170 CTTGGCGCACCTGGCTCTACAGG + Intronic
1171465472 20:25324894-25324916 CCTGGCTCAGCTGGAGCTAATGG - Intronic
1175692969 20:61079289-61079311 CCTGACCCTCCTGCCGCTGAGGG + Intergenic
1176303531 21:5111369-5111391 CCCTGCTCTCCTGGCGCTCAGGG + Intergenic
1178617054 21:34143701-34143723 CCAGGCCCTCCTGGCGCTTTGGG - Intergenic
1179853499 21:44150581-44150603 CCCTGCTCTCCTGGCGCTCAGGG - Intergenic
1183350310 22:37331157-37331179 CCTGGTGGGCCCGGCGCTAATGG - Intergenic
1185056029 22:48578803-48578825 CCTGGGGCTCCTGATGCCAAGGG - Intronic
954132228 3:48566667-48566689 CCTGGAGCTCCTGGCGAGAGAGG - Exonic
954508224 3:51097631-51097653 ACTGGCGCTCCAGGCGCCACTGG + Intronic
954532988 3:51337020-51337042 CCTGGCTCTGCTAGCGCTAAAGG + Intronic
961047858 3:123721753-123721775 CCTGGAGCTTCTGGAGCTAAGGG + Intronic
961270099 3:125681811-125681833 CCTGGAGCTTCTGGAGCTAAGGG - Intergenic
961558842 3:127714983-127715005 CCTGGAGCCCCTGGCGCTGCTGG - Intronic
973155409 4:46945389-46945411 CCTGCCTCTCCTGGAGCAAAGGG + Intronic
978795676 4:112705732-112705754 CATGGCTCTCCTGGCGATAGCGG + Intergenic
981819206 4:148867039-148867061 CCTGGCCCTCTGGGCCCTAAAGG - Intergenic
985520976 5:373802-373824 CCTGGCGCTCCCCGCGCTCCTGG + Intronic
985781957 5:1876317-1876339 CCGGGCGCTCCTGGGGCTCGGGG + Intergenic
999285973 5:150394519-150394541 CCTGACCCTACTGGAGCTAAGGG + Intronic
1002047264 5:176549156-176549178 CCTGGCGCTCCTGGGGCTGGAGG - Intronic
1002082992 5:176748514-176748536 CCGGGCACTCCTGGCCCTCACGG + Intergenic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1002449625 5:179311221-179311243 CCTGGCGCTCCTGGCCCAGGTGG + Intronic
1004547364 6:16610944-16610966 CCTTGACCTCCTGGCTCTAAAGG - Intronic
1007749309 6:44062415-44062437 CCTGGGGGTCCTGGGACTAAGGG + Intergenic
1008673235 6:53794595-53794617 CCTGGCGCCCCCGGCGCGCAAGG + Intronic
1011625441 6:89279588-89279610 CCTGGAACTCCTGGCCTTAAGGG + Intronic
1015935320 6:138402704-138402726 CCTGGGGCTCCTGGCTCTCAGGG + Intergenic
1022951298 7:35340593-35340615 GCTGGCCTTCCTGGCTCTAATGG + Intergenic
1029436518 7:100566953-100566975 CTCGGCGCTCCTGGCATTAAGGG - Exonic
1029596031 7:101538063-101538085 CCTGGTGCTCCTGGGGCTGGGGG - Intronic
1030482275 7:110119811-110119833 ACTGGGGCTCCAGGCGCTAATGG - Intergenic
1037572603 8:20171411-20171433 CCTGGCCTTCCTGGCACTACTGG - Exonic
1047410389 8:124619861-124619883 CCTGCCGCTGATGGCCCTAAAGG - Intronic
1048871472 8:138802888-138802910 GTTGGCGCTCCTGGACCTAAGGG - Exonic
1049802126 8:144522765-144522787 CATCGCGCTGCTGGCGCTCACGG - Exonic
1053696272 9:40642261-40642283 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
1054307519 9:63441480-63441502 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
1054307523 9:63441489-63441511 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
1054406251 9:64765491-64765513 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
1054439878 9:65250964-65250986 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
1054490528 9:65770975-65770997 CCTGGGGCTCCTGGGGCTCCTGG + Intergenic
1057054096 9:91948810-91948832 TCTGGCGCTCCTGGGCCTGAAGG + Intronic
1057696030 9:97323619-97323641 CCTGGCCCTCCAGACCCTAAGGG + Intronic
1057883043 9:98807761-98807783 GTTGGTGCTCCTGGCGCTACTGG + Exonic
1059436905 9:114282517-114282539 CCTGGCACTCCAGGCCCTAAAGG + Exonic
1060480002 9:124012259-124012281 CCTGGCGCTCCTGGCGCTAACGG - Exonic
1061882687 9:133575934-133575956 ACTGCCGCTCCTGGAGCTCATGG + Intergenic
1062112392 9:134789170-134789192 CCTGGATTTCCTGGCGCCAATGG + Exonic
1202778720 9_KI270717v1_random:15922-15944 CCTGGGGCTCCTGGGGCTCCTGG - Intergenic
1191608120 X:63083368-63083390 CCTTGAGCTCCTTGAGCTAAAGG + Intergenic
1197191062 X:123648432-123648454 CCTGGTGTTCCAGGCGCTACTGG - Intronic
1200275487 X:154728381-154728403 CCTGGCGCTCTAGGCGCTCTTGG - Intronic