ID: 1060480447

View in Genome Browser
Species Human (GRCh38)
Location 9:124014035-124014057
Sequence ACTGCTTGTCCACCGCCAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060480447_1060480451 28 Left 1060480447 9:124014035-124014057 CCTGCTGGCGGTGGACAAGCAGT 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1060480451 9:124014086-124014108 GTGCAAGCTCAACCTGGAGTCGG 0: 1
1: 0
2: 0
3: 8
4: 97
1060480447_1060480450 22 Left 1060480447 9:124014035-124014057 CCTGCTGGCGGTGGACAAGCAGT 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1060480450 9:124014080-124014102 CTGCGAGTGCAAGCTCAACCTGG 0: 1
1: 0
2: 0
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060480447 Original CRISPR ACTGCTTGTCCACCGCCAGC AGG (reversed) Exonic
900235604 1:1588518-1588540 ACTGCCTGTCCACCCTCAGATGG - Intergenic
901365036 1:8739576-8739598 TTTGCTTTTCCTCCGCCAGCTGG - Intronic
906708333 1:47911020-47911042 ACTGCTTCTCCACCATCACCAGG - Intronic
910117887 1:83752464-83752486 ACTGCCTTTCCAACCCCAGCTGG + Intergenic
912413668 1:109494195-109494217 ACTGCCTCTCCGCAGCCAGCGGG - Exonic
912437359 1:109671185-109671207 ACTGCTTGCCCGCGGCCAGCTGG + Intronic
913077767 1:115355552-115355574 ACTGCTTGTCCATATCCAGCGGG + Intergenic
915541414 1:156569374-156569396 ACCGCTTGGCCTCCTCCAGCCGG + Exonic
1072196240 10:93119266-93119288 TCTGCTTGTTCACCTCCTGCTGG + Intergenic
1076061719 10:127418554-127418576 ACTGCTTGCCCAGAGCAAGCTGG - Intronic
1076685070 10:132194876-132194898 ACTGCTCGTAGGCCGCCAGCAGG - Exonic
1076897624 10:133321062-133321084 ACTGCCTCCCCACCCCCAGCCGG - Intronic
1078434633 11:11314252-11314274 ACTGCTTCTCCCCAGCCTGCAGG + Intronic
1084492091 11:69484409-69484431 GCTTCTTGTCCACCTCCAGAAGG + Intergenic
1084936836 11:72591296-72591318 CATGCTTCTCCACCGCCTGCAGG + Exonic
1085175908 11:74488058-74488080 AATGCATGTCCATCGTCAGCAGG + Intergenic
1089080275 11:115770424-115770446 ACTCCATGGCCACCACCAGCAGG - Intergenic
1089300388 11:117495226-117495248 CCTGCCTGCCTACCGCCAGCTGG - Intronic
1092518578 12:9241884-9241906 ACTGCTTGTCCACCTGCATTCGG - Intergenic
1103330121 12:120148444-120148466 ACTGCTTGAGCACCGTCTGCAGG - Intronic
1108601028 13:51995451-51995473 ACTGCTTGTGGACAGACAGCAGG + Intronic
1111317209 13:86578214-86578236 TCTGTTTCTCCACTGCCAGCAGG + Intergenic
1115820868 14:37211350-37211372 ACTGCTTCCCCACTCCCAGCAGG + Intronic
1119294424 14:73521431-73521453 ACAGCCTGTCCACCACCAGGTGG - Intronic
1120833327 14:89017416-89017438 ACTGCATGTCCAGAGCCAGAGGG + Intergenic
1121485409 14:94310706-94310728 CCTGATTGTCCGCCACCAGCAGG + Intronic
1122131260 14:99605349-99605371 ACGGCGCGTCTACCGCCAGCAGG + Intergenic
1123886407 15:24732019-24732041 ACTGCATCTCCACTGCCACCAGG + Intergenic
1127600078 15:60526649-60526671 ACAGCTTGTCCTCCCCCAGGTGG + Intronic
1129426709 15:75468771-75468793 ACTGACTCTCCACGGCCAGCAGG + Exonic
1129746492 15:78025300-78025322 ACTGCAGGTCCAGAGCCAGCAGG - Exonic
1132547293 16:539267-539289 ACTGCTGGTCAACCCACAGCCGG + Intronic
1132689163 16:1174867-1174889 CCTGCCTGCCCACCGCCAGCTGG - Intronic
1133025187 16:2986113-2986135 CCTGCTTGGCCACTGCCAGAGGG - Intergenic
1136144746 16:28309989-28310011 AACGCTTGCCGACCGCCAGCAGG + Intronic
1136162015 16:28426284-28426306 ACGGCTGGTCCACAACCAGCTGG + Intergenic
1136200951 16:28688706-28688728 ACGGCTGGTCCACAACCAGCTGG - Intronic
1136217291 16:28802890-28802912 ACGGCTGGTCCACAACCAGCTGG - Intergenic
1136288906 16:29260037-29260059 CCTGCATGGCCACCTCCAGCCGG + Intergenic
1137027505 16:35492527-35492549 ACTCCCTGGCCACCGCCAGCAGG - Intergenic
1141102903 16:81211037-81211059 ACTGCTGGCCCAGAGCCAGCTGG + Intergenic
1142094634 16:88232944-88232966 CCTGCATGGCCACCTCCAGCCGG + Intergenic
1144579308 17:16449256-16449278 ACTGCTTGTCCACTAGCAGAGGG - Intronic
1149041646 17:52196823-52196845 CCTGCTTGTCAAGCCCCAGCTGG - Intergenic
1149456688 17:56793924-56793946 ACTTCTATTCCACTGCCAGCAGG + Intronic
1150136346 17:62697336-62697358 CCAGCGTGTCCACCTCCAGCAGG - Intergenic
1151585046 17:75003732-75003754 ACTGCTCGTCCACCTCCCGCAGG - Exonic
1152621775 17:81368486-81368508 GCTCCCTGTCCACCCCCAGCAGG - Intergenic
1155075279 18:22348875-22348897 ACCGCTTCTCCAGCGCCAGGAGG - Intergenic
1160631818 18:80251984-80252006 CCTGCATGTCCACCCCCAGGTGG + Intergenic
1160930540 19:1567860-1567882 ACAGCTGGTCCAGCGCCAGGCGG + Exonic
1161535844 19:4818053-4818075 ACAGCTTCTCCTCAGCCAGCAGG + Exonic
1161602299 19:5191844-5191866 AGTCCTTGTCCACAGCCGGCGGG - Intronic
1161739672 19:6013026-6013048 ACTGCGTGTCCTCCTGCAGCCGG + Exonic
1161761014 19:6172894-6172916 GCTCCTTGTCCTCAGCCAGCAGG + Intronic
1163161869 19:15469697-15469719 GCTGCTGGGCCACCGCCAGCTGG - Exonic
926301910 2:11610937-11610959 AGTGCTCCTCCAGCGCCAGCCGG - Exonic
929595666 2:43174115-43174137 CCTGCTTGTCCACCCAGAGCCGG - Intergenic
932216349 2:69968782-69968804 ACTGCTTGTCCCCAGCGACCAGG - Intergenic
938191156 2:129281963-129281985 GCTCCTTGTCCACACCCAGCAGG + Intergenic
948983938 2:241508677-241508699 ACTTGTAGTCCAACGCCAGCAGG - Exonic
1169083640 20:2814075-2814097 GCTGCATATCCACCTCCAGCAGG - Intergenic
1171142363 20:22754244-22754266 ACAATTTGTCCACCACCAGCAGG + Intergenic
1174826238 20:53771192-53771214 TCTCCTTGCCCCCCGCCAGCTGG + Intergenic
1175889431 20:62309791-62309813 TCTGCGCGTCCACCTCCAGCCGG + Exonic
1176195523 20:63835028-63835050 TTTCCTTGTCCACCCCCAGCTGG + Intergenic
1176623453 21:9073475-9073497 CCGGCCTGGCCACCGCCAGCTGG - Intergenic
1179679374 21:43007586-43007608 CCTGCTTGTCCACATCCATCGGG - Exonic
1179809089 21:43858975-43858997 ACTGAATGTCCACCGCCTGGAGG - Intergenic
1179809106 21:43859036-43859058 ACTGAGTGTCCACCGCCTGGAGG - Intergenic
1181040728 22:20191481-20191503 CCTGCTTGCCCACCCCCAGCAGG + Intergenic
1183020204 22:35020772-35020794 ACTGCGTGAACACAGCCAGCTGG + Intergenic
1184549535 22:45197093-45197115 CCTACCTGTCCACCGCCACCGGG - Exonic
1184867567 22:47209970-47209992 GCTGCTTGTGCACCTCCCGCTGG - Intergenic
950020798 3:9786298-9786320 ACTGCAAGGCCACCGTCAGCTGG + Intronic
951522119 3:23620040-23620062 ACTGCTAGTCCACTGCCCCCAGG + Intergenic
952916358 3:38247504-38247526 AGTGCATGTCCTCCTCCAGCAGG + Intronic
955040165 3:55308693-55308715 ACTACCTCTCCACCGCCAGTGGG - Intergenic
955391594 3:58526214-58526236 CCTGCTTCTCCACAGGCAGCCGG - Intronic
968831143 4:2933607-2933629 ACTGGTTTGCCACCGCCATCGGG - Exonic
971971443 4:33625927-33625949 ACTGCTTGTCTACCACCTGCTGG + Intergenic
975584903 4:75940220-75940242 ACTGCGTGTGCACTGCGAGCGGG + Intronic
975837545 4:78440498-78440520 ATTGCTTGACCATCTCCAGCAGG + Intronic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
986707615 5:10464374-10464396 TCTGCTTCTGCACCGCCATCCGG + Intronic
995798004 5:115962117-115962139 ACACCTGCTCCACCGCCAGCTGG - Intergenic
999682402 5:154072528-154072550 GCTGCTCTTCCACAGCCAGCAGG + Intronic
1000765754 5:165286766-165286788 ACTGGCTGTCCACGGCCACCAGG + Intergenic
1001933416 5:175688551-175688573 ACGGCGTGGCCCCCGCCAGCAGG + Intergenic
1002054891 5:176593139-176593161 TCTGCTTTCCCACCCCCAGCTGG - Intronic
1002342666 5:178527132-178527154 CCTGCTTGTCCACACCCATCTGG - Intronic
1014942955 6:127465040-127465062 AATGCTTGTCCACCACAAGAGGG + Intronic
1016231510 6:141810956-141810978 ACTGCTTCTTCAAGGCCAGCAGG - Intergenic
1017185468 6:151596403-151596425 CCTGCTTCTCCTCCTCCAGCTGG - Exonic
1023862377 7:44224403-44224425 ACAGCTTGTCCTCAGCCAGCAGG - Intronic
1023981089 7:45070435-45070457 ACTGCTCCACCACTGCCAGCTGG - Intronic
1025227945 7:57180083-57180105 ACTGCTTGGCCACCGTCTGCAGG + Intergenic
1026488028 7:70837779-70837801 ACTGTTTGTGCACCTCCGGCAGG - Intergenic
1032239443 7:130149584-130149606 ACTGCTGGTCCCCAGGCAGCAGG - Intergenic
1034460520 7:151195601-151195623 CCTCCTTGTCCACAGCCAGACGG + Exonic
1035280914 7:157777376-157777398 ACTGCGTGTCCTCCGGCATCAGG - Intronic
1035280933 7:157777488-157777510 ACTGCGTGTCCTCCGGCATCAGG - Intronic
1045529392 8:102970171-102970193 ACTGCCTTTCCACCTGCAGCTGG + Intronic
1046366984 8:113246974-113246996 ACTTCTGGTCCTCCACCAGCAGG - Intronic
1047347670 8:124043842-124043864 ACTGCATGACCACCTCCAGGAGG - Intronic
1049684632 8:143934379-143934401 ACTCCTTCTCCACATCCAGCGGG + Exonic
1052283121 9:26755028-26755050 TCTGCTTATCCAGCGCCGGCTGG - Intergenic
1059696329 9:116733447-116733469 ACTGCTCCTCCACCGGCAGCGGG + Exonic
1060009994 9:120035428-120035450 CCTGCTTTTCAACCTCCAGCAGG + Intergenic
1060480447 9:124014035-124014057 ACTGCTTGTCCACCGCCAGCAGG - Exonic
1061927113 9:133811323-133811345 TCTGCTTCTCCACCACCAGCTGG + Intronic
1062287270 9:135778730-135778752 TCTCCTTGTCCACCACCACCAGG - Exonic
1203746637 Un_GL000218v1:43903-43925 CCGGCCTGGCCACCGCCAGCTGG - Intergenic
1185930598 X:4198854-4198876 AATGCTTGTACACTGCCAGTAGG - Intergenic
1201159965 Y:11158917-11158939 CCGGCCTGGCCACCGCCAGCTGG - Intergenic