ID: 1060481707

View in Genome Browser
Species Human (GRCh38)
Location 9:124019995-124020017
Sequence GGCTCCTTGTGGTTAGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060481687_1060481707 23 Left 1060481687 9:124019949-124019971 CCCCACCCCCAATGCCAGCCAGG No data
Right 1060481707 9:124019995-124020017 GGCTCCTTGTGGTTAGGGACAGG No data
1060481695_1060481707 15 Left 1060481695 9:124019957-124019979 CCAATGCCAGCCAGGCATTGGCA No data
Right 1060481707 9:124019995-124020017 GGCTCCTTGTGGTTAGGGACAGG No data
1060481696_1060481707 9 Left 1060481696 9:124019963-124019985 CCAGCCAGGCATTGGCAGCGTGG No data
Right 1060481707 9:124019995-124020017 GGCTCCTTGTGGTTAGGGACAGG No data
1060481692_1060481707 17 Left 1060481692 9:124019955-124019977 CCCCAATGCCAGCCAGGCATTGG No data
Right 1060481707 9:124019995-124020017 GGCTCCTTGTGGTTAGGGACAGG No data
1060481686_1060481707 30 Left 1060481686 9:124019942-124019964 CCATATTCCCCACCCCCAATGCC No data
Right 1060481707 9:124019995-124020017 GGCTCCTTGTGGTTAGGGACAGG No data
1060481694_1060481707 16 Left 1060481694 9:124019956-124019978 CCCAATGCCAGCCAGGCATTGGC No data
Right 1060481707 9:124019995-124020017 GGCTCCTTGTGGTTAGGGACAGG No data
1060481690_1060481707 21 Left 1060481690 9:124019951-124019973 CCACCCCCAATGCCAGCCAGGCA No data
Right 1060481707 9:124019995-124020017 GGCTCCTTGTGGTTAGGGACAGG No data
1060481698_1060481707 5 Left 1060481698 9:124019967-124019989 CCAGGCATTGGCAGCGTGGCCCC No data
Right 1060481707 9:124019995-124020017 GGCTCCTTGTGGTTAGGGACAGG No data
1060481689_1060481707 22 Left 1060481689 9:124019950-124019972 CCCACCCCCAATGCCAGCCAGGC No data
Right 1060481707 9:124019995-124020017 GGCTCCTTGTGGTTAGGGACAGG No data
1060481691_1060481707 18 Left 1060481691 9:124019954-124019976 CCCCCAATGCCAGCCAGGCATTG No data
Right 1060481707 9:124019995-124020017 GGCTCCTTGTGGTTAGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060481707 Original CRISPR GGCTCCTTGTGGTTAGGGAC AGG Intronic