ID: 1060483059

View in Genome Browser
Species Human (GRCh38)
Location 9:124029315-124029337
Sequence CCCCGGTGCATGGCAGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 198}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060483059_1060483065 1 Left 1060483059 9:124029315-124029337 CCAGTCTCTGCCATGCACCGGGG 0: 1
1: 0
2: 0
3: 15
4: 198
Right 1060483065 9:124029339-124029361 ACATGAAGATAGCATAGAAAGGG No data
1060483059_1060483064 0 Left 1060483059 9:124029315-124029337 CCAGTCTCTGCCATGCACCGGGG 0: 1
1: 0
2: 0
3: 15
4: 198
Right 1060483064 9:124029338-124029360 GACATGAAGATAGCATAGAAAGG No data
1060483059_1060483068 26 Left 1060483059 9:124029315-124029337 CCAGTCTCTGCCATGCACCGGGG 0: 1
1: 0
2: 0
3: 15
4: 198
Right 1060483068 9:124029364-124029386 CCTGCTCCCATCAAACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060483059 Original CRISPR CCCCGGTGCATGGCAGAGAC TGG (reversed) Intronic
900156676 1:1205988-1206010 CCCAGGTGCAGGTCAGAGGCAGG + Intronic
900547147 1:3235534-3235556 CCCCGCTGCCTGGCAGAGAAAGG + Intronic
900574040 1:3374231-3374253 CCCCAGAGCAGGGCAGAGAAGGG - Intronic
900576157 1:3383453-3383475 CCCCAGAGCACAGCAGAGACAGG - Intronic
900664761 1:3807755-3807777 CCACTGTGCCTGGCTGAGACTGG + Intergenic
900994332 1:6112335-6112357 CCCCCGTGCTTGGCAGAGAGAGG - Intronic
901635599 1:10668788-10668810 GCCCTGTGCTTGGCACAGACAGG - Intronic
901671892 1:10860938-10860960 CCACGGTGCAGGGAACAGACTGG + Intergenic
902564598 1:17303019-17303041 CTCCAGTGCAGGGCAGAGCCTGG + Intergenic
902881226 1:19373099-19373121 CCCCTGAGGATGGCAGAGAAGGG + Intronic
903344711 1:22676956-22676978 CCCCAGTGCGCGGCAGAGCCGGG - Intergenic
906534835 1:46545692-46545714 CCCCGATGCCTGGCAGGGCCAGG - Intronic
908550669 1:65205923-65205945 CACAGGTGCATGGCACATACAGG - Intronic
912956828 1:114159982-114160004 CCCATGTGCCTGGCACAGACTGG - Intergenic
914706162 1:150171624-150171646 CCACTGTGCTTGGCAGAGAAGGG - Intergenic
916853750 1:168728840-168728862 CCCCAGTGCAGTGCAGGGACTGG + Intronic
917660402 1:177171833-177171855 CCCTGGTGCCTGGCAGTGGCAGG + Intronic
917804610 1:178602215-178602237 CCCCCTTGCATTGCAGGGACTGG - Intergenic
922724183 1:227914869-227914891 CCCTGGAGCCTGGCAGAGGCAGG + Intergenic
1062760115 10:11568-11590 CCCCGCTGAATGGCAGGGTCAGG - Intergenic
1063665893 10:8060385-8060407 CCACGGTGCCTGGCAGGGGCTGG + Intronic
1066759661 10:38739570-38739592 CACCGGTCCAGGGCAGAGGCAGG - Intergenic
1067063514 10:43090247-43090269 CCCAGGTGCAGGGAAGACACAGG + Intronic
1067677713 10:48399436-48399458 CCCAGGAGCAGGGCAGAGGCAGG - Intronic
1069411794 10:68161731-68161753 CCTCGATCCATGGCAGAGCCAGG + Exonic
1069560119 10:69423275-69423297 CCCTGGAGCATGGCAAAGAAAGG + Intergenic
1069782986 10:70968523-70968545 GCTCGTTACATGGCAGAGACAGG + Intergenic
1072633326 10:97161983-97162005 CCCAGGTGCCTGGCATAGAGTGG + Intronic
1073663232 10:105500957-105500979 CACGGATGCATGGGAGAGACAGG - Intergenic
1074549839 10:114432408-114432430 CTCCTGTGTATGGAAGAGACAGG - Intronic
1074849309 10:117426242-117426264 CCCAGTTCCATGGCAGAGAAGGG + Intergenic
1074943042 10:118253793-118253815 CCCCAGTGCATGGCAGCAACGGG - Intergenic
1075023824 10:118969367-118969389 CCCAGGTGCAGGGGAGAGCCTGG + Intergenic
1075443154 10:122494973-122494995 CCCCGGGACATGGCAGTGGCGGG + Intronic
1075588691 10:123676125-123676147 CCCCTGTGGATTGCAGACACTGG + Intronic
1076313478 10:129524387-129524409 GCACGGTGCATGGCAGAGCTGGG - Intronic
1076517671 10:131057295-131057317 CCCCGATGCCTGGGAGAGGCAGG - Intergenic
1077024294 11:432444-432466 CCACTGTGCAGAGCAGAGACTGG + Intronic
1077453992 11:2667052-2667074 CCCCCGTGCATTTCAGAGACGGG - Intronic
1078902955 11:15658546-15658568 CCCCGAGGCATGGCTGAGACAGG + Intergenic
1080681216 11:34477894-34477916 CTCAGGAGCATGGCAGGGACTGG - Intergenic
1081695992 11:45109457-45109479 CATCTGTGCATGGTAGAGACAGG - Intronic
1083147873 11:60772362-60772384 CCCAGGTGCTGGGCAGAGAATGG + Intronic
1083978082 11:66140494-66140516 TCACGGTGCATGGCTGAGAGAGG + Intronic
1084366536 11:68704986-68705008 CCCCGGCCCCCGGCAGAGACTGG - Intergenic
1085711020 11:78829282-78829304 CCCTGGTCCATGGCAGAGCATGG + Intronic
1088623873 11:111714474-111714496 CCCCGGTGCAGGGGAGAAACTGG + Intronic
1088815675 11:113419177-113419199 GCCCAGTACATGGCAGAGTCGGG + Intronic
1090518872 11:127457772-127457794 CCCTGGTGCAACCCAGAGACTGG - Intergenic
1098659758 12:73076816-73076838 CCCCAGTCCATGGCTGAGATGGG - Intergenic
1103576672 12:121882601-121882623 CTCCAGTGCATGGGACAGACAGG + Intergenic
1103784237 12:123420310-123420332 CCACTGCGCCTGGCAGAGACGGG + Intronic
1105779009 13:23690231-23690253 CCCGGGTGCACTGCAGACACTGG - Intergenic
1107339393 13:39389654-39389676 CCCCGGTGTGTGGCAGACAGTGG + Intronic
1113838234 13:113343572-113343594 CCGCTGTACATGGCAGAGCCTGG - Intronic
1113937113 13:114000301-114000323 CCTGGGTGCATGGCAGGGCCAGG - Intronic
1114293910 14:21312350-21312372 CCCCTGTCCATGGCAGGGAGGGG - Intronic
1114526925 14:23372281-23372303 CCCCGGTGGGGGGCAGTGACTGG + Intergenic
1114577656 14:23728615-23728637 CCCCTGTGGATAGCAGAGACAGG + Intergenic
1115431670 14:33326177-33326199 CCGCAGTGCAGGACAGAGACAGG + Intronic
1118319339 14:64743869-64743891 CCCCAGTGGATGGCACAGGCAGG - Exonic
1121310329 14:92932294-92932316 CCCCAGGGAGTGGCAGAGACTGG + Intronic
1121456557 14:94042419-94042441 CCCCAGTGCCTGGCACAGAGGGG + Intronic
1121504881 14:94469503-94469525 CCCTGGTGGATGGCAGACTCTGG + Exonic
1122269988 14:100564724-100564746 CCACAGTGCCTGGCAGAGGCTGG - Intronic
1122976767 14:105174064-105174086 CCCCGTAGCATGGCAGAGTGGGG + Intronic
1123139436 14:106061109-106061131 CCACGGTGGATGGCAGATGCAGG + Intergenic
1123421986 15:20142360-20142382 CGCCGGTCCAGGGCAGAGGCAGG + Intergenic
1123443090 15:20304275-20304297 CCTCGGTCCAGGGCAGAGGCAGG - Intergenic
1123531214 15:21148900-21148922 CGCCGGTCCAGGGCAGAGGCAGG + Intergenic
1128525948 15:68412389-68412411 GCCCGGTGTATGGCTGAGGCAGG - Intronic
1129237217 15:74230873-74230895 CTCCGGTGCCTGGCAGAACCAGG + Intergenic
1130236896 15:82143944-82143966 CCCAGCTGCATGGCTGAGGCAGG - Intronic
1131199066 15:90381093-90381115 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1133326682 16:4946144-4946166 GCTGGGTGCATGGCAGAGCCAGG - Intronic
1134241602 16:12510867-12510889 CCACGGTGCTTGGCACAGGCTGG - Intronic
1134415941 16:14043444-14043466 CCACAGTGCATGCCAGACACAGG - Intergenic
1134860319 16:17554903-17554925 CCCGTGTGCCTGGCAGAGATTGG + Intergenic
1137935305 16:52629384-52629406 CCCACGTGCAAGGCAAAGACTGG - Intergenic
1141157314 16:81606336-81606358 CCAGGGTGCATGGGAGAGCCAGG + Intronic
1203124325 16_KI270728v1_random:1561463-1561485 CGCCGGTCCAGGGCAGAGGCAGG - Intergenic
1143528274 17:7484753-7484775 CCCCCGTGCATGGCGGAGGCAGG - Exonic
1143601834 17:7951952-7951974 CGCTGGTGCATGCCAGAGAGTGG - Intergenic
1143733085 17:8892200-8892222 CCCGGGGACAGGGCAGAGACAGG + Intronic
1144504339 17:15817377-15817399 CTCCGGTGCAAGGCAGAAGCCGG - Intergenic
1144946449 17:18971854-18971876 CCCTGGTGAATGGCAGAGCCAGG - Intronic
1145168196 17:20632886-20632908 CTCCGGTGCAAGGCAGAAGCCGG - Intergenic
1145966151 17:28919180-28919202 CCCAGGGGCATGGCAGTGAGCGG + Exonic
1146164281 17:30575855-30575877 CTCCGGTGCAAGGGAGAGGCCGG - Intergenic
1147652168 17:42068925-42068947 GCCCTGTGCCTCGCAGAGACGGG + Intergenic
1148789602 17:50166000-50166022 GCCCGGTGAGTGACAGAGACAGG - Exonic
1149551756 17:57545802-57545824 CCCAAGTGCCTGGCAGAGAAGGG + Intronic
1149896066 17:60429426-60429448 CCCCCATGCATGGCAGAGCTTGG - Exonic
1152172822 17:78764795-78764817 CCCATGTGCATGCCAGAAACAGG - Intronic
1152953022 18:11922-11944 CCCCGCTGAATGGCAGGGTCAGG - Intergenic
1153653145 18:7259282-7259304 GGCCGGCACATGGCAGAGACGGG - Intergenic
1155247351 18:23923275-23923297 CTCTAGTGCAGGGCAGAGACTGG + Intronic
1155360389 18:24993864-24993886 CCCCACTGAATGCCAGAGACCGG + Intergenic
1155509571 18:26563027-26563049 CTCGGGTGCATTGCAGAGATGGG - Intronic
1158343237 18:56488846-56488868 ACCTGGGGCATGGCAGGGACGGG - Intergenic
1158599715 18:58846954-58846976 CCCAGGTGCTTGGAAGAGACAGG - Intergenic
1158861646 18:61598330-61598352 TCCCTGTGCTTGGCAGAGAAAGG - Intergenic
1159261583 18:66020172-66020194 CCATGGTGCAGTGCAGAGACAGG + Intergenic
1160540433 18:79617557-79617579 CCCCGGGGAATGGCCGAGCCTGG - Intergenic
1161286332 19:3470233-3470255 CCCCTGTGCCTGGCACAGAGTGG - Intergenic
1161466679 19:4434818-4434840 GCCCGGTGTAAGGCACAGACAGG + Intronic
1161724905 19:5923144-5923166 CCCAGGTGCATGGAAGACCCAGG + Intronic
1162274782 19:9644485-9644507 CCACCGTGCCTGGCCGAGACTGG + Intronic
1162903491 19:13809233-13809255 CCCCGGTGCGTGGTGGACACCGG + Intronic
1163013712 19:14441049-14441071 CCCCAGTCCAGGGCAGAGGCTGG + Intronic
1163457001 19:17412851-17412873 CCCCGGTGCAAAACAAAGACAGG - Intronic
1163708807 19:18833041-18833063 CCCCGGACCAGGCCAGAGACAGG - Intronic
1164468140 19:28505464-28505486 CCCAGGTGCCTGCCAGAGCCTGG - Intergenic
1167457591 19:49605581-49605603 ACACGGTGCATGGCTGAGTCGGG - Intronic
1167836904 19:52080422-52080444 CCCCAGTGCATGGCAGGGGCTGG - Intronic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
925992190 2:9262749-9262771 CCCAGTTGGATGGCAGAGCCTGG + Intronic
926229841 2:10994044-10994066 CACTGGTGCAGGGCAGGGACTGG - Intergenic
926706801 2:15843070-15843092 CCCTGGTCCATGGCACAGAGCGG + Intergenic
929694627 2:44103793-44103815 CCCCGTTCCACAGCAGAGACAGG - Intergenic
933398996 2:81767239-81767261 TCCCTGTGAATGGCAGACACAGG + Intergenic
934238860 2:90251370-90251392 CGCCGGTCCAGGGCAGAGGCAGG - Intergenic
934613061 2:95754978-95755000 CCCCACGCCATGGCAGAGACAGG - Intergenic
934647843 2:96069444-96069466 CCCCACACCATGGCAGAGACAGG + Intergenic
934841215 2:97625265-97625287 CCCCACACCATGGCAGAGACAGG + Intergenic
937892595 2:126950099-126950121 CCACTGTGCTTGGCCGAGACAGG - Intergenic
937956867 2:127426608-127426630 CCCCCATGCCTGGCAGAGAGGGG - Intronic
939680379 2:145123880-145123902 ACCCGCTTCATGGCAGAGCCTGG - Intergenic
940099164 2:150013944-150013966 CCCTGGGGATTGGCAGAGACAGG + Intergenic
942191847 2:173478189-173478211 GGCCGGTGGATAGCAGAGACAGG - Intergenic
944743603 2:202635153-202635175 CCCCGGTGACTGGGCGAGACGGG - Intergenic
944902607 2:204231019-204231041 CCACAGTGAATGGCAGAGCCAGG + Intergenic
946961639 2:224991676-224991698 CCAGGGTGCATGGCTGAGTCAGG + Intronic
947322654 2:228939245-228939267 CCACAGTACACGGCAGAGACAGG + Intronic
1168969966 20:1924312-1924334 CCCAGGTGCTGGGCACAGACCGG + Intronic
1170443101 20:16398449-16398471 CTCAGGTTCATGGCAGGGACAGG + Intronic
1172224941 20:33299261-33299283 CCCCGGTGTATGGCCGAGGATGG - Intronic
1175278717 20:57788497-57788519 ACCTAGTGCATGGCAGAGCCAGG + Intergenic
1175991864 20:62793816-62793838 CACCAGGGCATGGCAGGGACCGG + Intergenic
1180059156 21:45375719-45375741 CCCCAGTGATTGGCAGAGATGGG - Intergenic
1180137523 21:45871178-45871200 GCCCAGTGCCTGGGAGAGACAGG + Intronic
1182865194 22:33598210-33598232 AACCGGTACATGGCAGAGCCAGG - Intronic
1182962060 22:34484438-34484460 CAGCAGTGCATGTCAGAGACAGG - Intergenic
1185219700 22:49623231-49623253 CCCAGGTGGACGGCAGAGGCCGG + Intronic
1185234534 22:49704465-49704487 CCCGGGTGCAAGGCAGGGAATGG + Intergenic
1185382983 22:50518635-50518657 TCCCGGTGTCTGGGAGAGACAGG - Exonic
949162359 3:895665-895687 CTCCGGTGCCTGTCACAGACTGG - Intergenic
950451906 3:13070143-13070165 GCCCTGTGCATGGCACAGCCAGG - Intronic
950506720 3:13399677-13399699 CCCCGGTGGGAGCCAGAGACAGG - Intronic
950704256 3:14770124-14770146 CCCCTGAGAATGGCAGGGACTGG + Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955089292 3:55733332-55733354 CCCCAGTGTCTGGCAGTGACTGG + Intronic
957699591 3:83691257-83691279 CCCCGGGGCCTGTCAGAGTCGGG + Intergenic
958999803 3:100950210-100950232 GCACGGTGCCTGGCAGAGAAAGG + Intronic
961369363 3:126420052-126420074 GCCCTGTGCAGGGCAGAGCCAGG - Intronic
961474010 3:127135870-127135892 CGCCGGTGCGTGGCAGGGCCGGG - Intergenic
969318922 4:6399078-6399100 CCAGGGTGCAGGGCAGAGATAGG + Intronic
970433563 4:16011349-16011371 GCCCAGTGCCTGGCAGAGCCTGG + Intronic
971484143 4:27142325-27142347 CAAGGGTGCATGGCAGAGAAGGG + Intergenic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
977358903 4:95980305-95980327 CCCCAGTGCAGGGCAGACCCTGG - Intergenic
979099839 4:116599920-116599942 CCCCAGGGCATGGAAGGGACCGG - Intergenic
988547872 5:32174581-32174603 CCCCCGTGAATGGAAGAGCCTGG + Intergenic
997813905 5:136997869-136997891 CCCCAGTGCTGGGCAGAGTCAGG - Intronic
1001905186 5:175466329-175466351 CCCAAGTGCATGGCAGAGAGAGG - Intergenic
1002044241 5:176533096-176533118 CCCTGGTGTAAGGCAGAGAAAGG - Intronic
1002183066 5:177441441-177441463 CCCCTGGGGCTGGCAGAGACAGG - Intronic
1003045395 6:2728900-2728922 CCACGGTGGATGGCAGATCCTGG + Intronic
1007414314 6:41683199-41683221 CCCCGGTGCCTGGCGGGAACAGG - Intergenic
1008435103 6:51466685-51466707 GCCTGGTGCTTGGCAGAGAAGGG - Intergenic
1011630187 6:89315557-89315579 CCCTGGTGGATGGGACAGACTGG - Intergenic
1015279583 6:131418913-131418935 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1017701488 6:157077425-157077447 CTCCGGAGCCTGGCAGAGGCAGG - Intronic
1018913461 6:168117699-168117721 CCCAGGTGCCTGGCTGAGTCGGG - Intergenic
1019285352 7:220483-220505 CGAAGGAGCATGGCAGAGACGGG + Intronic
1020013891 7:4820250-4820272 CCCTGGAGGATGGCAGAGTCAGG + Intronic
1023226712 7:37977543-37977565 CCTCGGTAAATGGCAGAGAAAGG + Intronic
1024010213 7:45260433-45260455 CCCTGGTGCATTGTAGAGACAGG + Intergenic
1029271873 7:99381858-99381880 CCCCTGGGCAGGGCAGTGACGGG + Intronic
1034152810 7:148929951-148929973 GCACGGTGCCTGGCTGAGACAGG - Intergenic
1034270762 7:149802570-149802592 CTTCTGTGCATGGCAGAGAGGGG + Intergenic
1034491327 7:151394524-151394546 CCCTGGAGCAGGGCAGAGGCTGG + Intronic
1035750749 8:1994401-1994423 GCCCCGTGCATGGCTGTGACAGG + Intronic
1037956645 8:23065371-23065393 GCCAAGTGCAGGGCAGAGACTGG + Intronic
1038059667 8:23899129-23899151 ACCAGCTGCATGGCAGAGGCTGG + Intergenic
1038344896 8:26723402-26723424 CCCCAGTGGATGTCTGAGACTGG + Intergenic
1039850602 8:41361573-41361595 CCCCAGGGGATGGCAGAGAGTGG + Intergenic
1039969890 8:42312751-42312773 AGCCGGTGCGTGGCAGAGGCTGG - Intronic
1046877283 8:119269602-119269624 CCCAGGTGCAGGGCAGAAAAGGG - Intergenic
1047673263 8:127171932-127171954 CCCCAATGCATGGCAGAGTCTGG + Intergenic
1048965433 8:139611334-139611356 CACCTGTGAATGGCAGAGGCTGG + Intronic
1049549654 8:143251216-143251238 CCCCACTGCATGGCTGGGACGGG - Exonic
1051292186 9:15555839-15555861 CACCGGGGCCTGGCAGAGAGTGG - Intronic
1051398219 9:16650047-16650069 CCTGGGTGCATGGCAGAGGAAGG + Intronic
1052052742 9:23866592-23866614 CCCCTCTGCATGGCAGTGAAGGG + Intergenic
1058427484 9:104887424-104887446 CCTCGGTGAAGGGCAGAGGCAGG + Intronic
1059235970 9:112760940-112760962 CCAAGGTGAAGGGCAGAGACAGG + Intronic
1059334256 9:113558944-113558966 CCCCAGTGCATTTTAGAGACAGG + Intronic
1059389362 9:113989093-113989115 CCCTGGTGCATGCTGGAGACCGG - Intronic
1060188861 9:121579708-121579730 CCAAGGTGTGTGGCAGAGACAGG - Intronic
1060454968 9:123783646-123783668 CCCCTGTAAATGGCAGAGCCAGG + Intronic
1060483059 9:124029315-124029337 CCCCGGTGCATGGCAGAGACTGG - Intronic
1061677572 9:132227019-132227041 CCCCGGGGCATGGCACGTACAGG - Exonic
1187055463 X:15738117-15738139 CCAGGGTGGAGGGCAGAGACTGG + Intronic
1187529504 X:20083775-20083797 CCCCAGTGCTTGGCAAAGTCTGG + Intronic
1188856048 X:35197172-35197194 CCCAGGTGCAGGGCACAGAAGGG + Intergenic
1189066173 X:37811599-37811621 CCACTGTGCTTGGCAGAGAGCGG + Exonic
1189988755 X:46575432-46575454 GCCCGGGGCAAGGCAGGGACCGG + Intronic
1199607106 X:149586128-149586150 CCCTGATGCCTGGCAGAGCCTGG + Intronic
1199632016 X:149783240-149783262 CCCTGATGCCTGGCAGAGCCTGG - Intronic
1199874873 X:151921538-151921560 CCCCGATGCCAGGCAGAGCCTGG - Intronic
1200909326 Y:8516500-8516522 CCCCAGTGCTGGACAGAGACAGG - Intergenic