ID: 1060484188

View in Genome Browser
Species Human (GRCh38)
Location 9:124036859-124036881
Sequence CTCCCAGGGGGCCACAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060484183_1060484188 2 Left 1060484183 9:124036834-124036856 CCTGCTTTATTCATGGTGTGACT No data
Right 1060484188 9:124036859-124036881 CTCCCAGGGGGCCACAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060484188 Original CRISPR CTCCCAGGGGGCCACAGTGA TGG Intergenic
No off target data available for this crispr