ID: 1060484985

View in Genome Browser
Species Human (GRCh38)
Location 9:124041103-124041125
Sequence GAGCTGGGACGCCGGGTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060484960_1060484985 29 Left 1060484960 9:124041051-124041073 CCCGGACCGAGGCACGGTCCCGG No data
Right 1060484985 9:124041103-124041125 GAGCTGGGACGCCGGGTCTGGGG No data
1060484971_1060484985 10 Left 1060484971 9:124041070-124041092 CCGGGGGAGCCGGCCCGGGCACC No data
Right 1060484985 9:124041103-124041125 GAGCTGGGACGCCGGGTCTGGGG No data
1060484966_1060484985 23 Left 1060484966 9:124041057-124041079 CCGAGGCACGGTCCCGGGGGAGC No data
Right 1060484985 9:124041103-124041125 GAGCTGGGACGCCGGGTCTGGGG No data
1060484962_1060484985 28 Left 1060484962 9:124041052-124041074 CCGGACCGAGGCACGGTCCCGGG No data
Right 1060484985 9:124041103-124041125 GAGCTGGGACGCCGGGTCTGGGG No data
1060484976_1060484985 -4 Left 1060484976 9:124041084-124041106 CCGGGCACCGCGGCCATCGGAGC No data
Right 1060484985 9:124041103-124041125 GAGCTGGGACGCCGGGTCTGGGG No data
1060484975_1060484985 -3 Left 1060484975 9:124041083-124041105 CCCGGGCACCGCGGCCATCGGAG No data
Right 1060484985 9:124041103-124041125 GAGCTGGGACGCCGGGTCTGGGG No data
1060484973_1060484985 1 Left 1060484973 9:124041079-124041101 CCGGCCCGGGCACCGCGGCCATC No data
Right 1060484985 9:124041103-124041125 GAGCTGGGACGCCGGGTCTGGGG No data
1060484970_1060484985 11 Left 1060484970 9:124041069-124041091 CCCGGGGGAGCCGGCCCGGGCAC No data
Right 1060484985 9:124041103-124041125 GAGCTGGGACGCCGGGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060484985 Original CRISPR GAGCTGGGACGCCGGGTCTG GGG Intergenic
No off target data available for this crispr