ID: 1060486916

View in Genome Browser
Species Human (GRCh38)
Location 9:124053629-124053651
Sequence CAGGGTCTTGTCTCATGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060486916_1060486919 -5 Left 1060486916 9:124053629-124053651 CCTGGTCATGAGACAAGACCCTG No data
Right 1060486919 9:124053647-124053669 CCCTGGACCTAGCTGAGCTAAGG No data
1060486916_1060486922 22 Left 1060486916 9:124053629-124053651 CCTGGTCATGAGACAAGACCCTG No data
Right 1060486922 9:124053674-124053696 GAAAGATAGCATCATTATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060486916 Original CRISPR CAGGGTCTTGTCTCATGACC AGG (reversed) Intergenic
No off target data available for this crispr