ID: 1060489501

View in Genome Browser
Species Human (GRCh38)
Location 9:124072112-124072134
Sequence GGGTAGATGAATAAGAAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060489492_1060489501 26 Left 1060489492 9:124072063-124072085 CCTGGATGGGTGGTAGGAGAGGG No data
Right 1060489501 9:124072112-124072134 GGGTAGATGAATAAGAAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060489501 Original CRISPR GGGTAGATGAATAAGAAGGA TGG Intergenic
No off target data available for this crispr