ID: 1060490917

View in Genome Browser
Species Human (GRCh38)
Location 9:124083507-124083529
Sequence GTCCCCACCCCTACTTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060490911_1060490917 8 Left 1060490911 9:124083476-124083498 CCACCTCCCTACTCCTGATAAGG No data
Right 1060490917 9:124083507-124083529 GTCCCCACCCCTACTTCAGCTGG No data
1060490914_1060490917 2 Left 1060490914 9:124083482-124083504 CCCTACTCCTGATAAGGACTCTC No data
Right 1060490917 9:124083507-124083529 GTCCCCACCCCTACTTCAGCTGG No data
1060490910_1060490917 9 Left 1060490910 9:124083475-124083497 CCCACCTCCCTACTCCTGATAAG No data
Right 1060490917 9:124083507-124083529 GTCCCCACCCCTACTTCAGCTGG No data
1060490916_1060490917 -5 Left 1060490916 9:124083489-124083511 CCTGATAAGGACTCTCTTGTCCC No data
Right 1060490917 9:124083507-124083529 GTCCCCACCCCTACTTCAGCTGG No data
1060490913_1060490917 5 Left 1060490913 9:124083479-124083501 CCTCCCTACTCCTGATAAGGACT No data
Right 1060490917 9:124083507-124083529 GTCCCCACCCCTACTTCAGCTGG No data
1060490908_1060490917 20 Left 1060490908 9:124083464-124083486 CCTCCTGTGCACCCACCTCCCTA No data
Right 1060490917 9:124083507-124083529 GTCCCCACCCCTACTTCAGCTGG No data
1060490907_1060490917 27 Left 1060490907 9:124083457-124083479 CCTGTCTCCTCCTGTGCACCCAC No data
Right 1060490917 9:124083507-124083529 GTCCCCACCCCTACTTCAGCTGG No data
1060490909_1060490917 17 Left 1060490909 9:124083467-124083489 CCTGTGCACCCACCTCCCTACTC No data
Right 1060490917 9:124083507-124083529 GTCCCCACCCCTACTTCAGCTGG No data
1060490915_1060490917 1 Left 1060490915 9:124083483-124083505 CCTACTCCTGATAAGGACTCTCT No data
Right 1060490917 9:124083507-124083529 GTCCCCACCCCTACTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060490917 Original CRISPR GTCCCCACCCCTACTTCAGC TGG Intergenic
No off target data available for this crispr