ID: 1060491417

View in Genome Browser
Species Human (GRCh38)
Location 9:124087960-124087982
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060491417_1060491422 6 Left 1060491417 9:124087960-124087982 CCCCTGTGCCTGGCTTTTTTCTT No data
Right 1060491422 9:124087989-124088011 GTTGCTTTTTCCAGGTTGAATGG No data
1060491417_1060491423 7 Left 1060491417 9:124087960-124087982 CCCCTGTGCCTGGCTTTTTTCTT No data
Right 1060491423 9:124087990-124088012 TTGCTTTTTCCAGGTTGAATGGG No data
1060491417_1060491428 18 Left 1060491417 9:124087960-124087982 CCCCTGTGCCTGGCTTTTTTCTT No data
Right 1060491428 9:124088001-124088023 AGGTTGAATGGGCATAGGGTGGG No data
1060491417_1060491424 13 Left 1060491417 9:124087960-124087982 CCCCTGTGCCTGGCTTTTTTCTT No data
Right 1060491424 9:124087996-124088018 TTTCCAGGTTGAATGGGCATAGG No data
1060491417_1060491427 17 Left 1060491417 9:124087960-124087982 CCCCTGTGCCTGGCTTTTTTCTT No data
Right 1060491427 9:124088000-124088022 CAGGTTGAATGGGCATAGGGTGG No data
1060491417_1060491421 -2 Left 1060491417 9:124087960-124087982 CCCCTGTGCCTGGCTTTTTTCTT No data
Right 1060491421 9:124087981-124088003 TTTTTTAAGTTGCTTTTTCCAGG No data
1060491417_1060491430 23 Left 1060491417 9:124087960-124087982 CCCCTGTGCCTGGCTTTTTTCTT No data
Right 1060491430 9:124088006-124088028 GAATGGGCATAGGGTGGGGCAGG No data
1060491417_1060491429 19 Left 1060491417 9:124087960-124087982 CCCCTGTGCCTGGCTTTTTTCTT No data
Right 1060491429 9:124088002-124088024 GGTTGAATGGGCATAGGGTGGGG No data
1060491417_1060491425 14 Left 1060491417 9:124087960-124087982 CCCCTGTGCCTGGCTTTTTTCTT No data
Right 1060491425 9:124087997-124088019 TTCCAGGTTGAATGGGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060491417 Original CRISPR AAGAAAAAAGCCAGGCACAG GGG (reversed) Intergenic