ID: 1060491425

View in Genome Browser
Species Human (GRCh38)
Location 9:124087997-124088019
Sequence TTCCAGGTTGAATGGGCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060491420_1060491425 6 Left 1060491420 9:124087968-124087990 CCTGGCTTTTTTCTTTTTTAAGT No data
Right 1060491425 9:124087997-124088019 TTCCAGGTTGAATGGGCATAGGG No data
1060491419_1060491425 12 Left 1060491419 9:124087962-124087984 CCTGTGCCTGGCTTTTTTCTTTT No data
Right 1060491425 9:124087997-124088019 TTCCAGGTTGAATGGGCATAGGG No data
1060491417_1060491425 14 Left 1060491417 9:124087960-124087982 CCCCTGTGCCTGGCTTTTTTCTT No data
Right 1060491425 9:124087997-124088019 TTCCAGGTTGAATGGGCATAGGG No data
1060491418_1060491425 13 Left 1060491418 9:124087961-124087983 CCCTGTGCCTGGCTTTTTTCTTT No data
Right 1060491425 9:124087997-124088019 TTCCAGGTTGAATGGGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060491425 Original CRISPR TTCCAGGTTGAATGGGCATA GGG Intergenic