ID: 1060493980 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:124104609-124104631 |
Sequence | GTGGATCCACTGATGCAGAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1060493980_1060493984 | 8 | Left | 1060493980 | 9:124104609-124104631 | CCTTTCTGCATCAGTGGATCCAC | No data | ||
Right | 1060493984 | 9:124104640-124104662 | TACCTTTCCTGCTCAAGGCGTGG | No data | ||||
1060493980_1060493983 | 3 | Left | 1060493980 | 9:124104609-124104631 | CCTTTCTGCATCAGTGGATCCAC | No data | ||
Right | 1060493983 | 9:124104635-124104657 | TTCACTACCTTTCCTGCTCAAGG | No data | ||||
1060493980_1060493985 | 9 | Left | 1060493980 | 9:124104609-124104631 | CCTTTCTGCATCAGTGGATCCAC | No data | ||
Right | 1060493985 | 9:124104641-124104663 | ACCTTTCCTGCTCAAGGCGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1060493980 | Original CRISPR | GTGGATCCACTGATGCAGAA AGG (reversed) | Intergenic | ||
No off target data available for this crispr |