ID: 1060493980

View in Genome Browser
Species Human (GRCh38)
Location 9:124104609-124104631
Sequence GTGGATCCACTGATGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060493980_1060493984 8 Left 1060493980 9:124104609-124104631 CCTTTCTGCATCAGTGGATCCAC No data
Right 1060493984 9:124104640-124104662 TACCTTTCCTGCTCAAGGCGTGG No data
1060493980_1060493983 3 Left 1060493980 9:124104609-124104631 CCTTTCTGCATCAGTGGATCCAC No data
Right 1060493983 9:124104635-124104657 TTCACTACCTTTCCTGCTCAAGG No data
1060493980_1060493985 9 Left 1060493980 9:124104609-124104631 CCTTTCTGCATCAGTGGATCCAC No data
Right 1060493985 9:124104641-124104663 ACCTTTCCTGCTCAAGGCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060493980 Original CRISPR GTGGATCCACTGATGCAGAA AGG (reversed) Intergenic
No off target data available for this crispr