ID: 1060494297

View in Genome Browser
Species Human (GRCh38)
Location 9:124106602-124106624
Sequence AAAACCTCACACTCTAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060494297_1060494303 21 Left 1060494297 9:124106602-124106624 CCTTCATTAGAGTGTGAGGTTTT No data
Right 1060494303 9:124106646-124106668 TCTCTCTGTGCGCCCAGCACAGG No data
1060494297_1060494304 26 Left 1060494297 9:124106602-124106624 CCTTCATTAGAGTGTGAGGTTTT No data
Right 1060494304 9:124106651-124106673 CTGTGCGCCCAGCACAGGCCTGG No data
1060494297_1060494298 -3 Left 1060494297 9:124106602-124106624 CCTTCATTAGAGTGTGAGGTTTT No data
Right 1060494298 9:124106622-124106644 TTTTGAGTTCAGACCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060494297 Original CRISPR AAAACCTCACACTCTAATGA AGG (reversed) Intergenic
No off target data available for this crispr