ID: 1060494298

View in Genome Browser
Species Human (GRCh38)
Location 9:124106622-124106644
Sequence TTTTGAGTTCAGACCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060494295_1060494298 3 Left 1060494295 9:124106596-124106618 CCACTTCCTTCATTAGAGTGTGA No data
Right 1060494298 9:124106622-124106644 TTTTGAGTTCAGACCCACCCTGG No data
1060494297_1060494298 -3 Left 1060494297 9:124106602-124106624 CCTTCATTAGAGTGTGAGGTTTT No data
Right 1060494298 9:124106622-124106644 TTTTGAGTTCAGACCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060494298 Original CRISPR TTTTGAGTTCAGACCCACCC TGG Intergenic
No off target data available for this crispr