ID: 1060494304

View in Genome Browser
Species Human (GRCh38)
Location 9:124106651-124106673
Sequence CTGTGCGCCCAGCACAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060494299_1060494304 -7 Left 1060494299 9:124106635-124106657 CCCACCCTGGATCTCTCTGTGCG No data
Right 1060494304 9:124106651-124106673 CTGTGCGCCCAGCACAGGCCTGG No data
1060494297_1060494304 26 Left 1060494297 9:124106602-124106624 CCTTCATTAGAGTGTGAGGTTTT No data
Right 1060494304 9:124106651-124106673 CTGTGCGCCCAGCACAGGCCTGG No data
1060494300_1060494304 -8 Left 1060494300 9:124106636-124106658 CCACCCTGGATCTCTCTGTGCGC No data
Right 1060494304 9:124106651-124106673 CTGTGCGCCCAGCACAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060494304 Original CRISPR CTGTGCGCCCAGCACAGGCC TGG Intergenic
No off target data available for this crispr