ID: 1060502724

View in Genome Browser
Species Human (GRCh38)
Location 9:124174215-124174237
Sequence GCTTGGAGGTTAGAAGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060502715_1060502724 19 Left 1060502715 9:124174173-124174195 CCCAAAGTTAGTTCAGCCTAGGC No data
Right 1060502724 9:124174215-124174237 GCTTGGAGGTTAGAAGCAACAGG No data
1060502716_1060502724 18 Left 1060502716 9:124174174-124174196 CCAAAGTTAGTTCAGCCTAGGCC No data
Right 1060502724 9:124174215-124174237 GCTTGGAGGTTAGAAGCAACAGG No data
1060502720_1060502724 -3 Left 1060502720 9:124174195-124174217 CCCAGGAATAAAAAAGGACAGCT No data
Right 1060502724 9:124174215-124174237 GCTTGGAGGTTAGAAGCAACAGG No data
1060502721_1060502724 -4 Left 1060502721 9:124174196-124174218 CCAGGAATAAAAAAGGACAGCTT No data
Right 1060502724 9:124174215-124174237 GCTTGGAGGTTAGAAGCAACAGG No data
1060502718_1060502724 3 Left 1060502718 9:124174189-124174211 CCTAGGCCCAGGAATAAAAAAGG No data
Right 1060502724 9:124174215-124174237 GCTTGGAGGTTAGAAGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060502724 Original CRISPR GCTTGGAGGTTAGAAGCAAC AGG Intergenic
No off target data available for this crispr