ID: 1060504642

View in Genome Browser
Species Human (GRCh38)
Location 9:124188657-124188679
Sequence CTGGTCTACCAGCACTCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060504641_1060504642 -7 Left 1060504641 9:124188641-124188663 CCTTGCTGTTGAAGAGCTGGTCT No data
Right 1060504642 9:124188657-124188679 CTGGTCTACCAGCACTCCACTGG No data
1060504637_1060504642 25 Left 1060504637 9:124188609-124188631 CCATGGAAACTGGCAAATGCTAC 0: 6
1: 45
2: 116
3: 277
4: 580
Right 1060504642 9:124188657-124188679 CTGGTCTACCAGCACTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060504642 Original CRISPR CTGGTCTACCAGCACTCCAC TGG Intergenic
No off target data available for this crispr