ID: 1060507983

View in Genome Browser
Species Human (GRCh38)
Location 9:124212728-124212750
Sequence CAGGACACACACATGGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060507983_1060508002 26 Left 1060507983 9:124212728-124212750 CCTTCTCCCATGTGTGTGTCCTG No data
Right 1060508002 9:124212777-124212799 AGGATCAGGGCAGGCACATCGGG No data
1060507983_1060507998 17 Left 1060507983 9:124212728-124212750 CCTTCTCCCATGTGTGTGTCCTG No data
Right 1060507998 9:124212768-124212790 GGGAGACCCAGGATCAGGGCAGG No data
1060507983_1060507989 -5 Left 1060507983 9:124212728-124212750 CCTTCTCCCATGTGTGTGTCCTG No data
Right 1060507989 9:124212746-124212768 TCCTGTGATTGTGGGGTCCCTGG No data
1060507983_1060507992 -3 Left 1060507983 9:124212728-124212750 CCTTCTCCCATGTGTGTGTCCTG No data
Right 1060507992 9:124212748-124212770 CTGTGATTGTGGGGTCCCTGGGG No data
1060507983_1060507997 13 Left 1060507983 9:124212728-124212750 CCTTCTCCCATGTGTGTGTCCTG No data
Right 1060507997 9:124212764-124212786 CCTGGGGAGACCCAGGATCAGGG No data
1060507983_1060507995 12 Left 1060507983 9:124212728-124212750 CCTTCTCCCATGTGTGTGTCCTG No data
Right 1060507995 9:124212763-124212785 CCCTGGGGAGACCCAGGATCAGG No data
1060507983_1060507993 6 Left 1060507983 9:124212728-124212750 CCTTCTCCCATGTGTGTGTCCTG No data
Right 1060507993 9:124212757-124212779 TGGGGTCCCTGGGGAGACCCAGG No data
1060507983_1060507991 -4 Left 1060507983 9:124212728-124212750 CCTTCTCCCATGTGTGTGTCCTG No data
Right 1060507991 9:124212747-124212769 CCTGTGATTGTGGGGTCCCTGGG No data
1060507983_1060508001 25 Left 1060507983 9:124212728-124212750 CCTTCTCCCATGTGTGTGTCCTG No data
Right 1060508001 9:124212776-124212798 CAGGATCAGGGCAGGCACATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060507983 Original CRISPR CAGGACACACACATGGGAGA AGG (reversed) Intergenic
No off target data available for this crispr