ID: 1060509476

View in Genome Browser
Species Human (GRCh38)
Location 9:124221664-124221686
Sequence TAGGATAAAAACTCTGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060509476_1060509489 26 Left 1060509476 9:124221664-124221686 CCACTTACAGAGTTTTTATCCTA No data
Right 1060509489 9:124221713-124221735 CATGTCACAGGCGGGACTAATGG No data
1060509476_1060509481 2 Left 1060509476 9:124221664-124221686 CCACTTACAGAGTTTTTATCCTA No data
Right 1060509481 9:124221689-124221711 GGGGCAGCATCAGACCCCTGAGG No data
1060509476_1060509488 18 Left 1060509476 9:124221664-124221686 CCACTTACAGAGTTTTTATCCTA No data
Right 1060509488 9:124221705-124221727 CCTGAGGGCATGTCACAGGCGGG No data
1060509476_1060509482 3 Left 1060509476 9:124221664-124221686 CCACTTACAGAGTTTTTATCCTA No data
Right 1060509482 9:124221690-124221712 GGGCAGCATCAGACCCCTGAGGG No data
1060509476_1060509486 17 Left 1060509476 9:124221664-124221686 CCACTTACAGAGTTTTTATCCTA No data
Right 1060509486 9:124221704-124221726 CCCTGAGGGCATGTCACAGGCGG No data
1060509476_1060509483 14 Left 1060509476 9:124221664-124221686 CCACTTACAGAGTTTTTATCCTA No data
Right 1060509483 9:124221701-124221723 GACCCCTGAGGGCATGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060509476 Original CRISPR TAGGATAAAAACTCTGTAAG TGG (reversed) Intergenic
No off target data available for this crispr