ID: 1060510048

View in Genome Browser
Species Human (GRCh38)
Location 9:124225069-124225091
Sequence CAGTCACAGTGGCCCTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060510041_1060510048 29 Left 1060510041 9:124225017-124225039 CCTGCCTACCTTTCTCAGTGCAT No data
Right 1060510048 9:124225069-124225091 CAGTCACAGTGGCCCTTGTGAGG No data
1060510045_1060510048 6 Left 1060510045 9:124225040-124225062 CCAGTCAAAATCATGAGGCTCGA No data
Right 1060510048 9:124225069-124225091 CAGTCACAGTGGCCCTTGTGAGG No data
1060510043_1060510048 21 Left 1060510043 9:124225025-124225047 CCTTTCTCAGTGCATCCAGTCAA No data
Right 1060510048 9:124225069-124225091 CAGTCACAGTGGCCCTTGTGAGG No data
1060510042_1060510048 25 Left 1060510042 9:124225021-124225043 CCTACCTTTCTCAGTGCATCCAG No data
Right 1060510048 9:124225069-124225091 CAGTCACAGTGGCCCTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060510048 Original CRISPR CAGTCACAGTGGCCCTTGTG AGG Intergenic
No off target data available for this crispr