ID: 1060514632

View in Genome Browser
Species Human (GRCh38)
Location 9:124258112-124258134
Sequence TCCGGGCCGCGGGGCCCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 161}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060514632_1060514656 30 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514656 9:124258165-124258187 ACCCCCAGCCGGGCCGAGGGCGG 0: 1
1: 0
2: 2
3: 18
4: 226
1060514632_1060514647 0 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514647 9:124258135-124258157 GAAGGGCGGGGGCCGGGCGGCGG 0: 1
1: 0
2: 15
3: 179
4: 1550
1060514632_1060514646 -3 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514646 9:124258132-124258154 GGAGAAGGGCGGGGGCCGGGCGG 0: 1
1: 0
2: 15
3: 145
4: 1529
1060514632_1060514648 1 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514648 9:124258136-124258158 AAGGGCGGGGGCCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 90
4: 915
1060514632_1060514652 20 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514652 9:124258155-124258177 CGGGGCCGTCACCCCCAGCCGGG 0: 1
1: 0
2: 2
3: 18
4: 251
1060514632_1060514649 2 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514649 9:124258137-124258159 AGGGCGGGGGCCGGGCGGCGGGG 0: 1
1: 0
2: 19
3: 330
4: 2417
1060514632_1060514655 27 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514655 9:124258162-124258184 GTCACCCCCAGCCGGGCCGAGGG 0: 1
1: 0
2: 1
3: 7
4: 101
1060514632_1060514651 19 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514651 9:124258154-124258176 GCGGGGCCGTCACCCCCAGCCGG 0: 1
1: 0
2: 2
3: 8
4: 135
1060514632_1060514654 26 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514654 9:124258161-124258183 CGTCACCCCCAGCCGGGCCGAGG 0: 1
1: 0
2: 2
3: 8
4: 152
1060514632_1060514642 -7 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514642 9:124258128-124258150 GCCCGGAGAAGGGCGGGGGCCGG 0: 1
1: 0
2: 6
3: 82
4: 664
1060514632_1060514644 -6 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514644 9:124258129-124258151 CCCGGAGAAGGGCGGGGGCCGGG 0: 1
1: 0
2: 9
3: 49
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060514632 Original CRISPR TCCGGGCCGCGGGGCCCCAC CGG (reversed) Intronic