ID: 1060514642

View in Genome Browser
Species Human (GRCh38)
Location 9:124258128-124258150
Sequence GCCCGGAGAAGGGCGGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 753
Summary {0: 1, 1: 0, 2: 6, 3: 82, 4: 664}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1060514613_1060514642 30 Left 1060514613 9:124258075-124258097 CCCGCGCGCCGGTGAGTCGCCTG 0: 1
1: 0
2: 0
3: 6
4: 51
Right 1060514642 9:124258128-124258150 GCCCGGAGAAGGGCGGGGGCCGG 0: 1
1: 0
2: 6
3: 82
4: 664
1060514630_1060514642 -2 Left 1060514630 9:124258107-124258129 CCGGGCCGGTGGGGCCCCGCGGC 0: 1
1: 1
2: 5
3: 45
4: 305
Right 1060514642 9:124258128-124258150 GCCCGGAGAAGGGCGGGGGCCGG 0: 1
1: 0
2: 6
3: 82
4: 664
1060514632_1060514642 -7 Left 1060514632 9:124258112-124258134 CCGGTGGGGCCCCGCGGCCCGGA 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1060514642 9:124258128-124258150 GCCCGGAGAAGGGCGGGGGCCGG 0: 1
1: 0
2: 6
3: 82
4: 664
1060514619_1060514642 22 Left 1060514619 9:124258083-124258105 CCGGTGAGTCGCCTGGGGCTGGG 0: 1
1: 0
2: 4
3: 28
4: 291
Right 1060514642 9:124258128-124258150 GCCCGGAGAAGGGCGGGGGCCGG 0: 1
1: 0
2: 6
3: 82
4: 664
1060514625_1060514642 11 Left 1060514625 9:124258094-124258116 CCTGGGGCTGGGGCCGGGCCGGT 0: 1
1: 0
2: 4
3: 64
4: 724
Right 1060514642 9:124258128-124258150 GCCCGGAGAAGGGCGGGGGCCGG 0: 1
1: 0
2: 6
3: 82
4: 664
1060514614_1060514642 29 Left 1060514614 9:124258076-124258098 CCGCGCGCCGGTGAGTCGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 35
Right 1060514642 9:124258128-124258150 GCCCGGAGAAGGGCGGGGGCCGG 0: 1
1: 0
2: 6
3: 82
4: 664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1060514642 Original CRISPR GCCCGGAGAAGGGCGGGGGC CGG Intronic